Loading...
HomeMy WebLinkAboutCOM 0271.507 2012-2014 • Fact Sheet about Food Safety Issues of Genetically Engineered(GE) Crops Dr. Susan C. Miyasaka, Agronomist Dr. Russell Nagata, Plant Breeder "Foods consumed today are derived from plants and animals whose genetic makeup has been modified by sexual crosses and mutation. Recombinant DNA provides a new `'' Cn tool to make genetic modifications, and this technology is termed genetic engineering > Z� or biotechnology. (Lemaux, 2008)" w -<-1 ._ J-G "The safety of genetically engineered crops and foods,just as those created by classical ps c-)- breeding and mutation and grown conventionally or organically,needs to be evaluated = on a case-by-case basis so that informed decisions can be made about their utility, o � safety, and appropriateness. (Lemaux, 2008)" . What are the risks of eating transgenes? No negative effects on food safety have been found in commercialized GE crops. "To date, no scientifically valid demonstrations have shown that food safety issues of foods containing genetically engineered(GE)ingredients are greater than those from conventionally or organically produced foods. (Lemaux, 2008)" "Extensive risk assessment and safety testing of crops developed through the use of genetic engineering has shown that there are no varieties in use that pose risks to consumers. (Wieczorek and Wright, 2012)" "No reproducible data has shown that transgene DNA from commercialized GE crops behave differently than native plant DNA. (Lemaux, 2008)." "It was concluded that the transgenic soybean diet had no negative effect on fetal,postnatal, pubertal or adult testicular development [of mice]. (Brake and Evenson, 2004)" Do GE foods have changes in nutritional content? No substantial differences in nutritional content have been found between commercialized GE foods and non-GE foods. Our data show that the contents of nutrients... of GE Rainbow papaya are within the range of those of non-GE papaya and that the Rainbow cultivar is substantially similar to the non-GE cultivar. (Tripathi and others, 2010)" "The results [for Round-up Ready soybeans] demonstrated that the composition of these GE lines is equivalent to that of conventional soybean cultivars in the form consumed by humans. (Lemaux, 2008)" Have allergens been introduced through GE? No allergens have been introduced through commercialized GE crops, due to extensive food safety tests conducted prior to approval by FDA. Comm. No. 11 .5O1 Ref. To: P/PsM Tc- 1 Ref. Date JUL 0 2 1013 "Although not mandatory, to date all companies marketing new GE foods have consulted with the FDA and performed recommended analyses to determine if introduced proteins have properties that indicate possible allergenicity, i.e., similarities to known allergens, small size, slow digestibility,and/or high heat stability. (Lemaux, 2008)" "Following accepted allergenicity assessment criteria, our results show that the transgene- derived PRSV CP [Papaya Ring Spot Virus coat protein] does not pose a risk of food allergy. (Fermin and others, 2011)." "In recent years a variety of safety studies were conducted specifically on native Bt proteins to show that they do not have characteristics of food allergens or toxins. (Lemaux, 2008)" Can GE foods fed to animals result in transfer of transgenes to animals? DNA and proteins are broken down in the digestive tract. There is no scientific evidence to date that shows that transgenes or their products are transferred to animals fed GE foods or excreted from animals fed GE foods. "To date a large number of experimental studies with livestock have shown that rDNA [recombinant DNA] fragments or proteins derived from GM plants have not been detected in tissues, fluids or edible products of farm animals (Lemaux, 2008)." Can GE foods increase antibiotic resistance in human and animal intestinal flora? There is no scientific evidence to date that GE foods can transfer antibiotic resistance to gut bacteria. And current research now allows the removal of selection genes (antibiotic resistance genes) or marker genes (gus gene)from GE plants. "To demonstrate the fate of transgene DNA in humans, the antibiotic resistance gene from GE maize was shown not to transfer to gut bacteria in chickens fed GE maize. (Lemaux, 2008)" Why doesn't the FDA require labeling of GE foods? The FDA does require labeling of GE foods IF the product contains allergens and its source must be named. "If a food contains a new,potentially allergy-causing introduced protein, the label must state that the product contains the allergen and name its source. (Lemaux, 2008)." Are there positive benefits of GE crops on food safety? Bt corn can be SAFER to eat than non-GE corn,because of less damage due to corn earworms and lower infections of kernels by fungi that contain mycotoxins. "A positive aspect of safety regarding Bt corn is the lower levels of mycotoxins compared with non-Bt corn. Mycotoxins are toxic and carcinogenic chemicals produced as secondary metabolites of fungal colonization that occur as a result of insects such as the corn earworm carrying the mycotoxin containing fungi that infest the kernels following wounding." (Lemaux, 2008) 2 References: Brake, D.G. and D.P. Evenson. 2004. A generational study of glyphosate-tolerant soybeans on mouse fetal,postnatal,pubertal and adult testicular development. Food and Chemical Toxicology. 42:29-356. Fermin, G., R.C. Keith, J.Y. Suzuki, S.A. Ferreira, D.A. Gaskill,K.Y. Pitz, R.M. Manshardt, D. Gonsalves, and S. Tripathi. 2011. Allergenicity assessment of the Papaya Ringspot Virus coat protein expressed in transgenic Rainbow papaya. J. Agr. Food Chem. 59:10006-10012. Lemaux, P. 2008. Genetically engineered plants and foods: A scientist's analysis of the issues (Part I). Annu. Rev, Plant Biol. 59:771-812. Tripathi, S., J.Y. Suzuki, J.B. Carr,G.T. McQuate, S.A. Ferreira, R.M.Manshardt,K.Y. Pitz, M.M. Wall, and D. Gonsalves. 2011. Nutritional composition of Rainbow papaya, the first commercialized transgenic fruit crop. J. Food Composition and Analysis. 24: 140-147. Wieczorek, A . and M. Wright. 2012. History of Agricultural Biotechnology: How Crop Development has Evolved. Nature Education Knowledge 3(10):9. http://www.nature.com/scitable/knowledge/library/history-of-agricultural-biotechnology-how- crop-development-25885295 3 Fact Sheet on Genetically Engineered Crops–Environmental Issues Susan C. Miyasaka, Agronomist Russell Nagata, Plant Breeder "Genetically engineered(GE)crops and foods have been commercially available in the United States since 1995 and their adoption around the world followed, showing increases each year since their introduction. Whereas the majority of the acreage is in the United States,most farmers who grow these crops reside outside the United States—more than 10 million of the 12 million adopters are in developing countries. These GE crops created by recombinant DNA(rDNA)have been overwhelmingly accepted by farmers,but some consumers remain skeptical. (Lemaux, 2009)" "[T]o date most GE crops on the market harbor Bt [Bacillus thuringensis] and/or HT [Herbicide Tolerance] traits. (Lemaux, 2009)" Can Federal Regulatory Agencies Stop Planting of Genetically Engineered Crops That Pose a on Environmental Risks? Yes,the FDA,EPA,and USDA are the three federal agencies witl responsibilities to ensure that GE crops are safe for consumers and the environment. '` -C "GE crops and products made from them are under regulatory control of three federal agenci%r '1 n the Food and Drug Administration(FDA),the EPA, and the USDA. The FDA is responsible Tyr r food safety and labeling of foods and animal feeds from conventional and GE crops. The EPIC. g evaluates food safety and environmental issues associated with new pesticides and pesticidal 2 = products, such as Bt corn and the pesticidal Bt product it contains. The EPA's charge also includes GE plants in which a small part of a pest, such as a viral regulatory sequence (e.g., 35S promoter), is used. A division of the USDA,APHIS, oversees environmental safety of planting and field-testing GE plants to ensure GE crop field tests are performed under specified conditions and any unusual occurrences are reported. All three agencies do not oversee each GE crop; however, all have legal rights to demand immediate market removal of any product if valid scientific data show safety concerns for consumers or the environment. (Lemaux, 2009)" Will the Widespread Use of Bt Crops Lead to the Development of Insect Resistance to Bt? Yes, insects have developed resistance to Bt toxins in GE crops,similar to the way that they have developed resistance to Bt insecticides used by conventional and organic farmers. "Bt toxins are also called Cry toxins because they exist as crystals inside the bacterium. Full length Cry toxins are inactive until cleaved to generate their active form in the insect midget (236, 261)... The precision of Bt proteins for certain insects and their lack of effects in mammals are due to the specificity of receptor binding (Lemaux, 2009)." "The primary strategy in the field for delaying insect resistance to Bt crops is planting refuges of non-Bt crops near Bt crops. Although the strategies implemented to delay resistance have helped sustain efficacy of Bt crops longer than many scientists expected, field-evolved resistance to Bt crops was reported recently. (Lemaux, 2009)" 1 Could GE crops harm non-target organisms, such as butterflies? Yes,in a laboratory study, monarch butterfly caterpillars died when fed milkweed leaves dusted with GE corn pollen containing high levels of Bt. No,in field studies,the EPA concluded that monarch butterflies in and around Bt resistant corn fields were more threatened by widespread use of Bt and other pesticides used in conventional and organic corn crops. In a laboratory study,monarch butterflies died after eating milkweed leaves dusted with pollen from a Bt corn(variety 176). That variety of Bt corn had high levels of Bt in pollen and it has been withdrawn from the market. Other commercial varieties of Bt corn have low levels of Bt in pollen. (Lemaux, 2009) "After reviewing the data, the U.S. EPA concluded there was a very low probability of risk to monarch butterflies beyond 12 feet from the Bt corn field. (Lemaux, 2009)" "The EPA concluded from these studies that Bt corn was not a significant factor in field death of monarch larvae,particularly relative to factors such as the widespread use of pesticides and destruction of the butterfly's winter habitats (Lemaux, 2009)." Could the Use of Herbicide-Tolerant(HT) Genetically Engineered(GE) Crops Lead to `Superweeds'? Yes, herbicide-tolerant(HT)weeds could increase in HT GE cropping systems, similar to other cropping systems that use herbicides. Yes,herbicide tolerant weeds could also develop due to inter-breeding with HT GE crops, such as GE canola and weedy wild relatives. "Crop tolerance to herbicides is achieved(a)by mutations that render a plant not susceptible to the herbicide or(b)through the introduction of transgenes. (Lemaux, 2009). "[P]roblems with herbicide-resistant weeds are real,but not new. These problems have occurred with traditionally bred crops, as well as with HT GE plants. (Lemaux, 2009)" "But herbicide resistance is a problem for farmers regardless of whether they plant GM crops. (Gilbert, 2003)" "HT weeds can also arise because of outcrossing with HT GE crops... Canola, in particular, can naturally form crop-wild hybrids. (Lemaux, 2009)" Does the Use of Genetically Engineered Crops Result in Decreased Use of Pesticides? Yes, GE crops have resulted in significant reductions in the global Environmental Impact(El) of pesticide applications. Most Herbicide Tolerant(HT) GE crops are tolerant to the herbicide glyphosate. "[G]lyphosate use per acre has increased dramatically from 1995 to 2005, coupled with a concomitant dramatic drop in the use of other herbicides [that were less environmentally friendly]. (Lemaux, 2009)" "Cultivation of GE HT crops has also had other positive effects on the environment, i.e., increases in low-or no-till practices and use in combination with integrated pest management 2 schemes,which were made possible because early season pesticide sprays could be eliminated, allowing beneficial insects to establish. (Lemaux, 2009)" "In summary, numerous studies have been conducted on pesticide usage that analyzed different data sets and methods, sometimes leading to conflicting conclusions. Some studies showed pesticide use, expressed as AI [Active Ingredient] per unit area, decreased with introduction of GE HT and Bt crops; some studies showed increases. More recently, studies have focused on EI and these have shown reductions in EI, including on farm workers, consumers, and ecology. (Lemaux, 2009)" "On balance, herbicide-resistant GM crops are less damaging to the environment than conventional crops grown at industrial scale...GM crop technology delivered an 8.9% improvement to the environmental impact quotient—a measure that considers factors such as pesticide toxicity to wildlife (Gilbert, 2003)" Could Genes From Genetically Engineered Plants Move to Bacteria in the Field? Perhaps,over millennia. "Transfer of genes among nonsexually related organisms, e.g., from plants to bacteria, is called horizontal gene transfer...Recent sequence analyses of genes and proteins show that some genes have transferred from plants to bacteria; however, this exchange occurred over a very long evolutionary timeframe. (Lemaux, 2009)" Is the Loss of Honeybees Due to Genetically Engineered Crops? No. Colony Collapse Disorder is not due to GE crops,but may be related to exposure to pesticides and other stresses,or lack of genetic diversity in honeybees. In Hawaii,introductions of varroa mites and small hive beetles are responsible for declines in honeybees. "In 2008 a meta-analysis of 25 independent studies assessing effects of Bt Cry proteins on honeybee survival (mortality) showed that Bt proteins used in commercialized GE crops to control lepidopteran and coleopteran pests do not negatively impact the survival of honeybee larvae or adults. Thus there are no data in the scientific literature supporting direct or indirect damage to bees caused by currently approved GEcrops engineered to make Bt proteins. (Lemaux, 2009)" Could Accidental Movement of Transgenes Occur From Genetically Engineered Crops to Wild Relatives or Non-Genetically Engineered Varieties? Perhaps. Gene flow from GE crops to wild relatives or non-GE crops can occur, but it depends on the crop species. In the case of commercially grown GE `Rainbow' papaya, self-pollination occurs,reducing the likelihood to practically nil of accidental movement of transgenes to a non-GE self-pollinating variety. "Pollen drift is a major, although not the only, conduit through which unwanted genes end up in crops..."gene flow is not limited to GE varieties and its impact is dependent on the trait, not the means by which the gene was created. (Lemaux, 2009)" 3 "Very low pollen drift(0.8%)was detected in fruit of`Kapoho' trees in the border row of one plantation when 90 embryos were assayed per fruit,while no pollen drift was detected in four other commercial plantings in which eight embryos were tested per fruit. (Gonsalves and others, 2012)." "Generalizations about whether gene flow presents significant economic or environmental risks cannot be made for either conventionally bred or GE crops; case-by-case evaluation is required. Many major agricultural crops are sexually compatible with wild and/or weedy relatives, and, if the plants grow in overlapping regions, crop-to-weed or crop-to-wild relative gene flow could result. This outcrossing to wild populations can result in new combinations of genes that can improve, harm, or have no effect on the fitness of recipient plants. (Lemaux, 2009)" Have Transgenes moved from GE corn to Wild Relatives in Mexico? Perhaps; there are conflicting reports. A more important question is whether this accidental movement of transgenes has affected growth and fitness of Mexican corn? And there is no scientific evidence to answer that question yet. Quist (2001) showed that locally produced corn in Oaxaca, Mexico contained DNA segments used in GE maize to promote gene expression. However, GM crops are not approved for commercial production in Mexico. It's possible that local farmers planted seed from GM crops imported from the United States and then pollen flow moved the transgenes to locally grown corn varieties. (Gilbert, 2013) Later researchers did not find evidence of transgene flow in corn from Oaxaca,Mexico and Quist's (2001) study was criticized for technical deficiencies. Then, in 2009, Pineyro-Nelson and others (2009) found the same transgenes as Quist from samples taken in Oaxaca and across Mexico. (Gilbert, 2013) What Happens When Pollen Moves from Genetically Engineered Crops to Organic Crops? Accidental movement of transgenes from GE crops to organic crops will not result in loss of accreditation. Use of GE crop varieties in certified organic farming is specifically prohibited. "The presence of detectable levels of GE material in a crop does not constitute a violation of National Organic Program (NOP)regulations nor is it reason to lose accreditation, as long as the grower has not intentionally planted GE seed and has taken reasonable steps to avoid cross pollination....The USDA-NOP [National Organic Program] informed state agricultural departments that up to 2005 no organic farmer had lost organic certification because of AP of GE material. (Lemaux, 2009)" "Some consumers, however, expect foods labeled as organic not to contain GE ingredients and have zero tolerance for their presence. Achieving 100%purity for any agricultural commodity is a practical impossibility given the nature of our food system, the reproductive biology of plants, and the highly sensitive detection methods available to identify GE traits (Lemaux, 2009). 4 Are Indian Farmers Committing Suicide due to GE crops? No,this is a false claim by environmental activist Vandana Shiva. "During an interview in March,Vandana Shiva, an environmental and feminist activist from India,repeated an alarming statistic: "270,000 Indian farmers have committed suicide since Monsanto entered the Indian seed market,"she said. "It's a genocide." (Gilbert, 2013)" Researchers at the International Food Policy Research Institute in Washington DC showed that Ms. Shiva's claim is false,because the number of suicides among farmers between 1997 to 2007 did not change from around 20,000 per year over this 10-year period. (Gilbert, 2013) Can Organic, Conventional and Genetically Engineered Cropping Systems Coexist? Yes, organic,conventional, and GE cropping systems can co-exist,provided that strategies are developed to allow ALL neighbors to farm in an economically viable way. "Thus, coexistence strategies must be devised to allow both neighbors to farm in an economically viable manner." These strategies could include buffer areas (Lemaux, 2009). "One factor hampering coexistence is the demand for zero tolerance for GE presence. Achieving 100%purity with any biological system is impossible and would require a complete ban on growing GE crops. (Lemaux, 2009)" Can Use of Genetically Engineered Crops or Organic Farming Lead to More Sustainable Agricultural Production Systems? Yes,GE plants can contribute towards a more sustainable agriculture. "Sustainability has no single meaning, but one accepted definition is to meet the basic needs of today's inhabitants while preserving resources to enable future generations to flourish. (Lemaux, 2009)" GE plants have the potential to: a)increase water use and fertilizer efficiencies;b)remediate soil contaminants; c)increase no-till or low-till practices; d)to help reduce greenhouse gases; and e) produce higher yields without increasing land usage,particularly in developing countries. (Lemaux, 2009) References: Lemaux, P. 2009. Genetically engineered plants and foods: A Scientist's analysis of the issues (Part II). Annu. Rev. Plant Biol. 60:511-559. Gilbert,N. 2013. Case Studies: A hard look at GM crops. Nature. 497:24-26. http://www.nature.com/news/case-studies-a-hard-look-at-gm-crops-1.12907 Gonsalves, D., C. Gonsalves, J. Carr, S. Tripathi, T. Matsumoto, J. Suzuki, S. Ferreira, and K. Pitz. Assaying for pollen drift from transgenic `Rainbow' to nontransgenic `Kapoho' papaya under commercial and experimental field conditions in Hawaii. Trop. Plant Biol. 5:153-160. 5 Pineyro-Nelson,A. and others. 2009. Mol.Ecol. 18:750-761. Quist, D. and I.H. Chapela. 2001. Nature. 414:541-543. 6 Tropical Plant Biol.(2012)5:153-160 DOI 10.1007/s12042-011-9090-5 Assaying for Pollen Drift from Transgenic `Rainbow' to Nontransgenic `Kapoho' Papaya under Commercial and Experimental Field Conditions in Hawaii CO CI z —4 D. Gonsalves•C. Gonsalves•J. Carr•S. Tripathi• T. Matsumoto•J. Suzuki•S. Ferreira•K. Pitz �'• Received: 30 September 2011/Accepted: 13 December 2011/Published online: 12 January 2012 Springer Science+Business Media,LLC(outside the USA)2012 Abstract In 1992, papaya ringspot virus (PRSV) was dis- Pollen drift averaged 1.3% of tested embryos in field plots covered in the Puna district of Hawaii island where 95%of where individual hermaphrodite `Kapoho' trees were adja- the state of Hawaii's papaya was being grown. By 1998 cent to two or four `Rainbow' trees. In contrast, 67.4% of production in Puna had decreased 50%from 1992 levels.A tested embryos were GUS positive in similarly located fe- PRSV-resistant transgenic papaya `Rainbow' containing the male `Kapoho' trees. The very low transgene flow to close- coat protein gene of PRSV was released commercially in by`Kapoho'plantings is likely due to the fact that hermaph- Hawaii in 1998, and saved the papaya industry from further rodite trees are used commercially in Hawaii and that these devastation. In the ensuing years since the release of the trees are largely self-pollinated before the stigma is exposed transgenic papaya,a number of farmers grew hermaphrodite to external pollen. nontransgenic `Kapoho'papaya in close proximity to plant- ings of hermaphrodite transgenic `Rainbow' papaya. These Keywords Coexistence•Pollination•Risk assessment• plantings provided a unique opportunity to assay for Transgene flow•Hawaiian solo papaya transgenic-pollen drift under commercial conditions. Between 2004 and 2010, assays for the GUS (beta-glucu- Abbreviations ronidase) transgene in embryos were done to study PRSV papaya ringspot virus transgenic-pollen drift in commercial `Kapoho' plantings GUS beta-glucuronidase and in replicated field plots. Very low pollen drift (0.8%) was detected in fruit of`Kapoho' trees in the border row of one plantation when 90 embryos were assayed per fruit, Introduction while no pollen drift was detected in four other commercial plantings in which eight embryos were tested per fruit. Hawaii's papaya industry suffered severe damage starting in May 1992 when papaya ringspot virus (PRSV) was ob- Conununicated by:Ray Ming served in Hawaii island's district of Puna, where 95% of the state's papaya was being grown (Gonsalves 1998). The D.Gonsalves(®)•J.Carr T.Matsumoto•J.Suzuki USDA Pacific Basin Agricultural Research Center, PRSV-susceptible Hawaiian solo variety `Kapoho was the 64 Nowelo Street, dominant variety at the time. PRSV, an aphid transmitted Hilo,HI 96720,USA potyvirus (Gonsalves et al. 2008), spread rapidly in Puna e-mail:dennis.gonsalves @ars.usda.gov and by 1995 a great majority of papaya in Puna was infected C.Gonsalves by PRSV.By 1998,papaya production in Puna was down to 789 Hoolaulea Street, 11,793 metric tons as compared to 24,040 metric tons in Hilo,HI 96720,USA 1992. Hawaii's papaya industry was in a crisis. In the mid 1980s we started research to develop virus- S.Tripathi S.Ferreira•K.Pitz resistant transgenic papaya anticipating that PRSV would Department of Plant and Environmental Protection Sciences, University of Hawaii at Manoa, eventually enter Puna and would likely devastate produc- Honolulu,HI 96822,USA tion. We used the then new `pathogen-derived resistance' Springer 154 Tropical Plant Biol.(2012)5:153-160 approach (Sanford and Johnston 1985) which had been drift was not detected in four other test sites when eight shown to work with transgenic tobacco that contained the embryos were tested per fruit. In replicated field plots, low coat protein gene of tobacco mosaic virus (Powell-Abel et levels of pollen drift was also detected in hermaphrodite al. 1986). The concept of pathogen-derived resistance states `Kapoho' trees surrounded by hermaphrodite `Rainbow' that transgenic plants containing a gene of the pathogen plants, but pollen drift to female `Kapoho' plants was very would be resistant to that particular pathogen. In the work high. with transgenic tobacco, the coat protein gene of tobacco mosaic virus that was transferred into the tobacco imparted resistance to the virus. We applied this approach to papaya Results with the transfer of the coat protein gene of PRSV into the red-flesh, commercial Hawaiian solo variety `Sunset'. A Assessment of Transgene Flow in Keaau and Kalapana PRSV-resistant transgenic line (designated as 55-1) of Fields: 2004 and 2005 `Sunset' (Hamilton et al. 1993) was identified in 1991 (Fitch et al. 1992), and deregulated in 1997 (Gonsalves Initial pollen drift assays focused on four farms (Table 1); 1998). The `Rainbow' and `SunUp' cultivars were derived one in the Keaau area and the others in the Kalapana area of from line 55-1 and released to the papaya industry in May the Puna District. All the trees in the `Kapoho' fields were 1998. `SunUp' is a selection of transgenic line 55-1 that is tested and certified to be nontransgenic.The`Kapoho'fields homozygous for the coat protein transgene of PRSV, while were adjacent to `Rainbow'plantings but were separated by `Rainbow' is a yellow/orange flesh F1 hybrid of a cross 6.1 m to 15.2 m apart by a road or berm. In the Kalapana between transgenic `SunUp' and the yellow-flesh nontrans- site,the prevailing wind was from the ocean.Figure 1 shows genic `Kapoho' (Manshardt 1998). `Rainbow' is thus hemi- the K10 planting site of `Kapoho' and its associated zygous for the coat protein gene. `Rainbow' is currently the `Rainbow' field in Kalapana. One fruit was collected per major papaya cultivar grown in Hawaii, comprising about tree with eight embryos being tested for the GUS gene. 77%of the cultivated acreage in the state of Hawaii(NASS In Phase 1,half of the `Kapoho' trees in the border rows 2009). adjacent to the `Rainbow' fields were sampled. None of the The release of transgenic papaya allowed the reclamation embryos out of 1240 embryos tested from 155 fruit gave of previously infected plantations which in turn lowered the positive GUS reactions (Table 1). In Phase 2, the Kalapana virus pressure in Puna.By 2001,transgenic papaya made up fields (Table 1)were divided into four blocks and a total of about 45%of the plantings in Puna, and new plantations of 100 fruits per field were selected for sampling in a random nontransgenic papaya could be grown with much less infec- manner within a row. More fruits were sampled from the tion than prior to the release of the transgenic papaya. In rows closest to the`Rainbow' field and the amount sampled fact, a system of growing transgenic papaya around blocks of `Kapoho' and judicious rogueing of PRSV-infected `Kapoho' plants helped Hawaii continue to raise `Kapoho' Table 1 GUS assays to assess for transgenic-pollen drift from`Rain- in Puna,to supply the lucrative Japan market which did not bow'to`Kapoho'in commercial papaya farms in Keaau and Kalapana, yet allow the sale of transgenic papaya (Gonsalves and Hawaii Ferreira 2003). This growing of transgenic papaya in close Field/Location Phase la:Year 2004 Phase 2b:Year 2005 proximity to `Kapoho' provided a unique opportunity to assay for transgenic-pollen flow from commercial No. No.GUS+/ No. No.GUS+ `Rainbow' to adjacent or nearby `Kapoho' plantings. fruit no.tested fruit no.tested Furthermore, transgenic pollen flow could be accurately H1/Keaau 36 0/288 NT` NT monitored by assaying of embryos from seeds for the pres- K2/Kalapana 48 0/384 99 0/792 ence of the GUS marker gene via a histochemical test K10/Kalapana 26 0/208 100 0/800 (Jefferson et al. 1987). K12/Kalapana 45 0/360 97 0/776 Assays for transgenic-pollen drift from `Rainbow' to Totals 155 0/1240 296 0/2368 `Kapoho' were carried out in commercial fields during the — course of six years from 2004 to 2010. Since commercial a Phase 1 tested half the trees in the border row of Kapoho adjacent to papaya plantings in Hawaii are comprised almost exclusive- Rainbow.One fruit per tree and eight embryos per fruit were tested for GUS ly of hermaphrodites (Storey 1953), only hermaphrodite Phase 2 tested trees randomly in four blocks. Blocks nearest the plants were tested in commercial fields. Pollen drift was Rainbow had 50 trees tested;other blocks progressively farther distant detected at very low levels in `Kapoho' plants growing in from the Rainbow field had 30, 15,and 5 selected trees.Embryos and the first two rows adjacent to `Rainbow' papaya when large fruit per tree tested was the same as in phase 1 numbers of embryos (90)were assayed per fruit and pollen °NT=not tested Springer Tropical Plant Biol.(2012)5:153-160 155 two to three `Rainbow' plants; Treatment 2 had `Kapoho' plants surrounded by four`Rainbow'plants while treatment 3 was a 3 x3 planting of`Kapoho' that was surrounded by -' , }-� `Rainbow' plants (Fig. 4). Each treatment plot was sur- rounded by a border of`Sunup' plants. To measure pollen drift to female plants,a total of 4 female plants were includ- KAPOHO FIELD K10 RAINBOW ed in each treatment. Plants were 1.5 m apart within a row and 3.0 m apart between rows.Twelve embryos were tested from each fruit and one fruit was collected per tree. Results with hermaphrodite trees showed that pollen drift was highest in treatment 1 (2.2%)and lower in treatments 2 (0.3%) and 3 (0.7%) (Table 3). The differences between treatments were not statically significant (p<.05) as ana- lyzed with Kuskal-Wallis One Way Analysis of Variance Fig.1 Kalapana`Kapoho'K10 field that was sampled for pollen drift on Ranks(Kruskal and Wallis 1952).An average of 1.3%of from neighboring `Rainbow' field.Note that a berm is separating the the tested embryos was GUS positive. In contrast, an aver- `Kapoho'and`Rainbow'fields.See Table 1 for data age of 67.4% of the embryos from fruit of female plants tested were GUS positive(Table 3). decreased as the distance of the rows from the `Rainbow' Another test was done to check for pollen drift to multi- field increased. Again, no GUS positive reactions were ple fruits on the column of a tree within treatment 1. These observed in the 2368 embryos that were tested from 296 trees had tested negative in the above test when 12 embryos fruit(Table 1). Positive and negative control embryos gave from one fruit were tested per tree. Six fruits were tested expected reactions. from each of two trees and nine fruits were tested from a third tree. An average of 78 embryos were tested per fruit. Assessment of Transgene Flow in Pohoiki Field: 2008 Two of the 21 fruits had GUS positive embryos, one fruit and 2009 each from two trees. One tree had 2.6% GUS positive embryos of 501 that were tested, while the other had 1.5% The test in Pohoiki area of the Puna District was conducted GUS positive embryos out of 713 tested. to further maximize the probability for detecting pollen drift by testing a portion of a large `Kapoho'plantation separated from `Rainbow' plantings by only a field road(Figs. 2 and Discussion 3),and by sampling more embryos per fruit.Border rows of `Rainbow' and `Kapoho' were 3.8 m apart (Fig. 3). The Low levels (less that 1% of embryos tested) of transgenic- observed wind direction was out of the northwest, which pollen drift were detected in plantings of `Kapoho' trees would blow diagonally across the `Rainbow'block into the growing in the first two rows bordering adjacent `Kapoho' block.Ninety embryos were tested per fruit. `Rainbow' plantings in which 90 embryos were sampled GUS positive embryos were detected in 12 of the 32 per fruit. In contrast, pollen drift was not detected in four fruits that were sampled in Rows 1 and 2 (Table 2). A total other `Kapoho' plantings in which 8 embryos were tested of 22 GUS positive embryos were observed out of 2,880 per fruit. Transgenic-pollen drift was also low (1.3%) in that were tested in these rows. This translated to GUS hermaphrodite trees that were immediately adjacent to positive reactions in 0.7 and 0.8%of the embryos tested in `Rainbow' trees (see Fig. 4), but was very high (67.4%) in rows 1 and 2, respectively. Only one out of 1,080 embryos similarly situated female `Kapoho' trees. This is the first tested GUS positive in row 3. Fruit sampled in rows 5, 11, report on transgenic-pollen drift from `Rainbow' to and 17 did not have GUS positive embryos. `Kapoho' under commercial conditions. Although time consuming and laborious,we opted to use Waiakea Field Plots: Transgene Flow to `Kapoho' Plants the histochemical GUS staining test and to test individual Surrounded by `Rainbow' and `Sunup' Plants: 2009-2011 embryos to obtain quantitative data on pollen drift. The color reactions gave unambiguous plus or minus results. In order to simulate a very high transgenic-pollen `pressure' Furthermore, hand pollination of open `Kapoho' flowers situation, a replicated field plot trial was conducted at with pollen from `Rainbow' flowers resulted in fruit with Waiakea, which is located between Hilo and Keaau. The GUS positive embryos, which provided us confidence that experiment consisted of three treatments replicated three pollen from `Rainbow' flowers could successfully pollinate times. Treatment 1 had each `Kapoho' plant surrounded by `Kapoho' (unpublished data). Springer 156 Tropical Plant Biol.(2012)5:153-160 Fig.2 Pohoiki pollen drift :• t`. . location. Top is map of the .. ,t"' . • - - `Rainbow'and`Kapoho' ��% plantings and the site of the �_ %rj pollen drift experiment.Bottom + teSt$'ar%Jr , is the`Kapoho'block where 13.`F>• '` t�f pollen ollen drift was tested.Black '1 _ circles are the sampled ` -N, a+�04. `Kapoho'trees.Ninety embryos 4,i f R eh._ were sampled per fruit for GUS - t a%n+f?O �o DI gene. White arrow is the wind • .* ` '4: direction ;* , ` *, ; S4 ... '� is::!,., v wr I 1 c ~ +g4\$. Z Rainbow 69 holes 297' __ • row 1 • row2 •• • • row 3 •••• ••• •• • row6 17 rows 182' row 11 1 000000000 row 17 Our results are similar to those reported by Manshardt et detected GUS in 8% of hermaphrodite and 83% of female al. (2007)who measured pollen drift from an experimental trees (see Table 3). Manshardt et al. (2007) also calculated `Rainbow' block to surrounding border trees of `Sunrise' the outcrossing rate for hermaphrodite and female plants to papaya grown in the Kapoho area of Puna District(Ferreira be 7%and 43%.This was obtained by doubling the amount et al.2002).In that study,one fruit was sampled per tree and of GUS positive embryos since `Rainbow' is hemizygous 12 embryos were tested per fruit;the sampling scheme used for the GUS gene. If we treat our data similarly, our out- for our`high'pressure transgenic-pollen plots.Manshardt et crossing rate in the high pressure transgenic-pollen plots al. (2007) detected GUS positive embryos in 13% of 56 (Table 3) would average 2.6% and 100%. In addition to hermaphrodite trees and 70% of 44 female trees, while we the `Sunrise' cultivar, another notable difference between Springer Tropical Plant Biol.(2012)5:153-160 157 +' level of transgenic-pollen drift(GUS positive embryos/total tested)to hermaphrodite fruits was 52 times less(1.3 versus KAPOHO 67.4%)than to female plants. RAwEGW The commercial Hawaiian papaya industry is based on production of fruit from hermaphrodite plants of the Hawaiian solo papaya type.Our data suggest that transgenic pollen drift will be very low even if transgenic varieties are planted in close proximity to nontransgenic varieties. We believe that low pollen drift was due to the fact that her- ". maphrodite flowers are largely self pollinating, and there- F • oeaKO,-F, - fore less receptive to external pollen by the time the flower gam opens. Although we did not conduct tests of long distance - w` transgene flow, it is reasonable to conclude that relatively Fig.3 Pohoiki field where transgenic pollen drift from `Rainbow'to short isolation distances would be effective in preventing `Kapoho' was tested. Inset shows typical fruit column that was sam- transgene flow between hermaphrodite plantings. Manshardt pled. See Table 2 for results et al. (2007) failed to detect the GUS gene in embryos col- lected from fruit of`Sunrise'plants 400 meters from a block of our trials is that all of the border `Sunrise' trees were `Rainbow' papaya. Our data suggest that even less of an severely infected with PRSV at the time of sampling isolation distance would prove effective. This suggestion is (Ferreira et al. 2002), whereas our `Kapoho' trees were based on our failure to detect GUS positive embryos in her- not. It could be that the morphology or pollen receptivity maphrodite trees that were as near as about 17.4 m away from of flowers is altered in severely PRSV-infected papaya. `Rainbow' fields (Row 5 in Table 2). In contrast, we can The failure to detect transgenic-pollen drift in four expect that transgenic-pollen drift to female plants will occur `Kapoho'commercial plantings was rather unexpected since at higher frequencies since outcrossing is required to pollinate we tested 50%of the trees in the border rows adjacent to the the female flower. `Rainbow' fields. Several factors may have contributed to Our results from this work suggest that organic farmers our failure to detect pollen drift in those fields: 1) distance could grow nontransgenic papaya in fairly close proximity between `Rainbow' and `Kapoho' plantings, 2)the number to `Rainbow' papaya and still have very limited transgene of embryos sampled per fruit,and 3)hermaphrodite flowers flow to their plants. An added benefit of the practice of are poor providers, and/or acceptors, of external pollen. In having `Rainbow' plantings close by or surrounding their regard to distance,the`Kapoho'and`Rainbow'plantings at planting is that it might help to slow down the onset of Pohoiki were separated by 3.8 m compared to 6.1 to 15.2 m PRSV infection in the nontransgenic planting, and com- in the other farms.In the Pohoiki farm,we sampled 11 times bined with rogueing of infected plants, the rate of infection more embryos per fruit(90 versus 8) than in the Kalapana would be slower than in nontransgenic papaya plantings and Keaau farms. The impact of the hermaphrodite flower without the transgenic buffer(Gonsalves and Ferreira 2003). factor is illustrated by results from the `high' transgenic- In conclusion, our results show that low levels of trans- pollen pressure field plots. Despite these combined plots gene flow can be detected in the border rows of commercial (see Fig. 4) being overwhelmingly transgenic (86.3% of plantings of hermaphrodite trees of `Kapoho' adjacent to the 713 plants)less than 10%of the 82 hermaphrodite fruits `Rainbow'fields when a large number of embryos are tested yielded GUS positive embryos.In stark contrast,83%of the per fruit. In recent years, the circumstances of having female fruits yielded GUS positive embryos. Lastly, the `Kapoho' fields adjacent to `Rainbow' fields has decreased Table 2 GUS assays to assess for transgenic-pollen drift from Row No.Tested GUS+embryos found in: `Rainbow'field adjacent to `Kapoho'field in Pohoiki,Puna Trees Fruits Embryos Trees fruit GUS+Embryos %GUS+embryos 1 14 21 1890 4 9 14 0.74 2 9 11 990 3 3 8 0.81 3 12 12 1080 1 1 1 0.05 5 10 10 900 0 0 0 0 11 2 2 180 0 0 0 0 17 2 2 180 0 0 0 0 a90 embryos were tested per fruit Springer ,r■ 158 Tropical Plant Biol. (2012)5:153-160 Fig.4 Field plot layout of high 45.7 m pressure pollen drift 41- i experiment.ilk _`SunUp' *Mi 1* 0* 00 ** 0 0* 00 *0 *0 0* 0* 00 *0 0* 0+ trees, Q -`Rainbow'trees,and * 110 ® _`Kapoho'trees. `Kapoho' * 0 0 0 0 0 0 0 it, 0 0 0 0 0 0 0 illt. 0 0 0 0 0 0 0 1 trees were sampled for transgene 0 0 0 0 0 0 0 0 0 0®0 0 0 It 0 0 0 0 0 0 0 : pollen drift.@=female � Kapoho'.One f r u i t was 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 O O o .(il 0 0 collected per tree and 12 • Plot 7-Treatment 1 • Plot 8-Treatment 2 0 Plot 9- a ent 3 1 p 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0(• • 0 0 embryos per fruit were assayed 10 * 11 for the GUS gene 0 0 0 0 0 0 0 0 0 0 0 0 0 0 • 0000 • 00 O 0000 000 0 0000000 11- 0000000 1- i •0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 • • * • • *00 * 410, ** 4100 40, 00 *A* 0000,0 * 000 300 00 00 • 1 0 0 0 0 0 0 0 it 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 00000 00 t 0000000 it 000®000 0000000 0000000 0000000 0 • • Plot 4-Treatment 2 Plot 5-T atment 3 Plot 6-Treatment 1 w • 0000000 0000000 1 0000000 O3 * 0 0 0 0 0 0 0 it 0 0 0 0 0 0 0 1. 0 0 0 0 0 0 0 0 • o®o 0 o o o 0 0 0 0 0 0 0 •. 0 0 0 0 0 0 0 • • 0 0 0 0 0 0 0 It 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0* 0 * 00 00 0* 40 *0 00 *0 *0 iili. *0 *0 0* 0* : 0 0 0 0 0 0 0 0 0 0 0 0 0 0 • 0 0 0 0 0 0 0 • ii 1 0000®00 0000000 1 0000000 • 0 0 0 0 0 0 0 it 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 It O Plot 1-Treatment 1 Plot 2-Treatment 3 0 PI 3-Treatment 2 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 I • 0 0 0 0 0 0 0 10 0 0 0 0®0 0 • 0 0 0 0 0 0 0 I• 0000®00 ' 0000000 A 0000000 1 O 0 0 0 0 0 0 0 I 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 00 *000:000 *0 *0 *0 00 0* 0* 0* 00 • markedly because `Rainbow' papaya now makes up about largely due to the high risk of PRSV infection, and the fact 77%of Hawaii's production(NASS 2009). This situation is that consumers have readily accepted the transgenic papaya. Table 3 Transgenic-pollen drift to hermaphrodite and female`Kapoho'plants surrounded by`Rainbow'trees and an outer perimeter of`SunUp' trees Treatments No.Trees No Treesb with No Embryos No.Trees No Treesb with No Embryos Hermap GUS+Embryo GUS+/Total Female GUS+Embryo GUS+/Total 1 38 4 10/456(2.2%) 4 4 41/48(85.4%) 2 21 1 1/252(0.3%) 4 3 24/48(50%) 3 22 2 2/264(0.7%) 4 3 32/48(66.6%) Total 82 7 13/984(1.3%) 12 10 97/144(67.4%) a Treatment 1:Consisted of alternating rows of nontransgenic`Kapoho'and`Rainbow'.Five`Kapoho'test plants per row;three rows of`Kapoho' and four of`Rainbow'. Sec Fig.4 Treatment 2:Consisted of nine plants of non-transgenic`Kapoho',each surrounded on all sides by transgenic `Rainbow'plants. See Fig.4 Treatment 3:Consisted of a 3 x3 plant block of nine non-transgenic`Kapoho'plants surrounded by two rows of transgenic`Rainbow'plants.See Fig.4 b Twelve embryos were tested from one fruit of a tree Springer Tropical Plant Biol.(2012)5:153-160 159 Materials and Methods Phase 2 (2005) This approach used a stratified random design to test seeds from 100 trees in each of the three GUS Testing of Embryos from Seeds Kalapana farms with `Kapoho' that were adjacent to, or in close proximity to a `Rainbow' farm. Each `Kapoho' farm Mature green fruit were harvested from trees and kept at 4°C was divided into three, four row segments across the width until processed. Fruit were cut in half; mature black seeds of the field with the first row in the segment being the one were rubbed in a wire colander to remove the sarcotesta,and closest to the `Rainbow' farm. A fourth section contained laid out to dry or kept in the refrigerator. Embryos were the remainder of the rows on the farm. Using a randomizer excised from the seeds and tested for GUS in microtiter program available online (http://www.randomizer.org/form. plates as previously described (Cai et al. 1999). In a slight htm), 50, 30, 15, and 5 trees were identified for sample variation of the protocol, the seeds were cut in half and the collection from each of the four sections with the section embryos were excised and put into individual wells of a 96- closest to the`Rainbow'farm having the most trees sampled well microtiter plate containing 50 ul of 200 mM sodium and with progressively less sampled trees in sections further phosphate buffer(pH 7.0).When all embryos were added to away. One fruit was collected per tree and embryos from the wells, 50 ul of 2x X-Gluc substrate working solution 8 seeds from that fruit were tested for the GUS gene. was added to each well. The microtiter plate was covered with a film cover and held at room temperature(ca. 21.1 to 23.9°C) and read 3 or 4 h later or left overnight before a Pollen Drift Assays in a `Kapoho' Field Adjacent final reading. Plates were read visually for the blue color. to a`Rainbow'Field in Pohoiki Region of Puna:2008-2009 Each microtiter test plate had embryos from`Rainbow'seed as GUS positive controls and `Kapoho' seeds as GUS neg- In the Pohoiki area of the lower Puna District a subsection of ative controls. a `Kapoho' field adjacent to a `Rainbow' field was selected for testing(Figs.2 and 3).The field consisted of 6 blocks of certified GUS negative`Kapoho'trees that was adjacent to a Pollen Drift Assays in Commercial `Kapoho' Fields designated `Rainbow' field. The fields were separated by a Adjacent to `Rainbow' Fields in Keaau and Kalapana: 3.8 m farm road (tree to tree). The experiment used the 2004 and 2005 second block of certified`Kapoho'trees measuring 17 rows deep with approximately 64 trees per row.Row one was the The test sites for `Rainbow' and `Kapoho' were located in row fronting the field road that separated `Kapoho' from Keaau and in the Kalapana area of Puna (Table 1). The `Rainbow'. Trees were spaced about 1.4 m apart within the farms in Keaau were situated on 20.7 ha of land in Keaau row, and 3.4 m apart between rows. The observed wind Shipman Business Park located just outside of Hilo in the direction was out of the northwest and blew diagonally upper section of Puna District. Thirteen farms were planted across the `Rainbow' block to the `Kapoho' block. Fruits with `Rainbow', three with `Kapoho'. Test sites at were collected from 9/8/08 through 4/28/09. Generally one Kalapana, in the lower section of Puna District, were situ- fruit was collected per tree, except for row 1 where 1-3 ated among 45 farms. Five farms were planted in fruits were collected per tree.Ninety embryos per fruit were `Rainbow',36 in `Kapoho',and four in Sunrise with a total tested for GUS. of 47.8 ha.All`Kapoho'trees were tested and certified to be GUS negative. Pollen Drift Assays in Waiakea Field Plot of`Kapoho'Trees Surrounded by `Rainbow' and `Sunup' Trees: 2009-2011 Phase 1 (2004) Tests for pollen flow were conducted by assaying for transgenic embryos in seeds of fruit collected The field was located in Waiakea, which is just outside of from `Kapoho' trees in rows bordering a `Rainbow' block. Hilo, on the grounds of the germplasm repository of the Tests were on four farms, one in Keaau and three in USDA Pacific Basin Agricultural Research Center. Kalapana, in which the `Rainbow' and `Kapoho' blocks `SunUp', `Rainbow', and `Kapoho' plants were used in were between 6.1 m to 15.2 m apart separated by a road or these experiments. Papaya seeds were soaked overnight in a berm with vegetative growth (e.g. Fig. 1). One mature water,rinsed three times,soaked for 30 min in 2.5 mM GA3 green fruit per tree was collected from approximately 50% (Dr. Rod. Drew, personal communication) and planted in a of the `Kapoho' trees in the border rows. The collection 1:1 perlite:vermiculite medium in a seedling tray on a heat strategy was to pick fruit from 12 trees in succession, then mat (30°C) and with misting intervals set so temperatures skip 12 trees,and then collect fruit from 12 trees,and repeat would not exceed 30°C. Seeds generally germinated in 1 to the cycle until the end of the border row. Embryos were 4 weeks. Seedlings were transplanted at the 4 true leaf stage excised from eight seeds per fruit and tested for GUS. to cell packs consisting of 2 parts of Sunshine mix #4 Springer 160 Tropical Plant Biol.(2012)5:153-160 supplemented with 1 part of perlite. Plants were kept in a control of papaya ringspot virus in Hawaii. Plant Dis 86:101— covered greenhouse and fertilized bimonthly with 1 table- 105 Fitch MMM,Manshardt RM,Gonsalves D,Slightom JL,Sanford JC spoon of 16N-7P-13.3K plus micronutrients and monthly (1992)Virus resistant papaya derived from tissues bombarded with with 1 tablespoon/L of 30N-4.4P-8.4K foliar fertilizer. the coat protein gene of papaya ringspot virus. Biotechnology Seedlings were planted in the field 3 to 4 months after initial 10:1466-1472 transplant. Gonsalves D(1998)Control of papaya ringspot virus in papaya:A case study.Annu Rev Phytopathol 36:415-437 All papaya plants, with the exception of 12, were her- Gonsalves D,Ferreira S(2003)Transgenic papaya:A case for manag- maphrodites that were screened for sex by PCR prior to ing risks of papaya ringspot virus in Hawaii.Online Plant Health planting in the field(Matsumoto et al.2010). Papaya plants Progress.doi:10.1094/PHP-2003-1113-03-RV were arranged in three treatments of 1) alternating rows of Gonsalves D, Suzuki J,Tripathi S,Ferreira S(2008)Papaya ringspot virus (Potyviridae). In: Mahy B, Van Regenmortel M (eds) non-transgenic `Kapoho' and transgenic `Rainbow',2)nine Encyclopedia of Virology, 5 vols, 3rd Edn, Vol. 4, pp. vol. 4, plants of nontransgenic `Kapoho"surrounded by transgenic pp. 1-8.5 vols.Elsevier,Oxford `Rainbow' plants. 3) a 3 x3 plant block of nine nontrans- Hamilton RA, Ito PJ, Paull RE (1993) `Sunset' solo papaya. Hawaii genic`Kapoho'plants surrounded by two rows of transgenic Cooperative Extension Service Commodity Fact Sheet PA-(B) June,2p,2 pp `Rainbow' plants. These treatments were replicated three Jefferson R, Kavanaugh T, Bevan M (1987) GUS fusions: beta- times and randomized in nine 15.2 m x 24.4 m plots glucuronidase as a sensitive and versatile gene fusion marker in (Fig. 4). The plots were separated by a border comprised higher plants.EMBOJ 6:3901-3907 of`Sunup' plants spaced 1.5 m to 1.8 m apart and 3.0 m Kruskal WH,Wallis WA(1952)Use of ranks in one-criterion variance analysis.J Am Stat Assoc 47(260):583-621 from each plot. Plants within each plot were spaced 1.5 m Manshardt RM (1998) `UH Rainbow' papaya. University of Hawaii apart with rows 3.0 m apart. One fruit was picked per College of Tropical Agriculture and Human Resources New `Kapoho' test plant, and 12 embryos per fruit were tested Plants for Hawaii-1,2pp for the GUS gene. Transgenic papaya plants lossed to Manshardt R,Mello CL,Lum DS,Ta L(2007)Tracking Papaya Pollen Movement with the GUS Transgene Marker. Acta Horticulturae drought or damage from wild pigs were replaced as needed 740:183-187 by new seedling transplants of`Rainbow' or`SunUp'papa- Matsumoto TK, Zee FTP, Suzuki JY, Tripathi S, Can JP (2010) ya. The field planting was initiated October 2006 and corn- Determining Sex and Screening for the Adventitious Presence of pleted January 2007. Transgenic Material in Carica papaya L. Seed Germplasm. HortScience 45:161-164 NASS(2009).Hawaii Papayas.National Agricultural Statistics Service http://www.nass.usda.gov/Statistics by_State/Hawaii/ References Publications/Archive/xpap0809.pdf 8 pp. Powell-Abel P,Nelson RS,De B,Hoffmann N,Rogers SG,Fraley RT, Beachy RN (1986) Delay of disease development in transgenic Cai WQ,Gonsalves C,Tennant P,Fermin G,Souza M,Sarindu N,Jan plants that express the tobacco mosaic virus coat protein gene. FJ,Zhu HY, Gonsalves D (1999)A protocol for efficient trans- Science 232(4751):738-743 formation and regeneration of Carica papaya L.In vitro Cell Dev Sanford JC, Johnston SA (1985) The concept of parasite-derived Biol-Plant 35:61-69 resistance - Deriving resistance genes from the parasite's own Ferreira SA, Pitz KY, Manshardt R, Zee F, Fitch M, Gonsalves D genome.J Theor Biol 113:395-405 (2002) Virus coat protein transgenic papaya provides practical Storey WB(1953)Genetics of the papaya.J Hered 44:70-78 Q Springer A Journal of Food Composition and Analysis 24(2011)140- G� UNTY CLERK . .x� CotINTY nF HAWAII Contents lists available at ScienceDirect 0SITION ANALYSIS V4`' t Journal of Food Composition ancA n"PyM At111� 07 ELSEVIER journal homepage: www.elsevier.com/locate/jfca igro "j Original Article Nutritional composition of Rainbow papaya, the first commercialized transgenic fruit crop Savarni Tripathi a,b,Jon Y. Suzuki a,James B. Carr a, Grant T. McQuate a, Stephen A. Ferreira b, Richard M. Manshardt c, Karen Y. Pitz b, Marisa M. Wall a, Dennis Gonsalves a'* a USDA-ARS-Pacific Basin Agricultural Research Center,Hilo,HI 96720,USA b Department of Plant and Environmental Protection Sciences,College of Tropical Agriculture and Human Resources,University of Hawaii at Manoa,Honolulu,HI 96822,USA `Department of Tropical Plant and Soil Sciences,College of Tropical Agriculture and Human Resources,University of Hawaii at Manoa,Honolulu,HI 96822,USA ARTICLE INFO ABSTRACT Article history: Rainbow papaya(Carica papaya L)is a genetically engineered(GE)cultivar with resistance to papaya Received 10 October 2009 ringspot virus(PRSV).This cultivar currently accounts for about 70%of Hawaii's papaya acreage.The Received in revised form 29 July 2010 nutritional composition of Rainbow papaya and a non-transgenic control were analyzed to address GE Accepted 31 July 2010 food safety concerns regarding the potential for altered nutritional composition and altered expression of Available online 27 November 2010 inherent allergens and toxic proteins.Rainbow papaya fruit were analyzed at three ripening stages and the data compared to that of a non-transgenic papaya which shares a similar pedigree.No differences Keywords: were observed between GE and non-GE papaya for 36 nutrients at any of the tested fruit ripeness stages. Papaya Carica papaya L. However,vitamin A was higher and calcium levels were lower in the GE fruit.The GE fruit showed higher Papaya ringspot virus(PRSV) levels of protein and papain at the earliest stage of ripening(color break), but in ripened fruit these Food safety differences were insignificant.Benzyl isothiocyanate(BITC)levels were very low and similar for both Papain Rainbow and the non-transgenic control fruit at all ripeness stages.Our data show that the contents of BITC nutrients,BITC and papain of GE Rainbow papaya are within the range of those of non-GE papaya and that Minerals the Rainbow cultivar is substantially similar to the non-GE cultivar. Transgenic Published by Elsevier Inc. Vitamin A Vitamin C Food composition Food analysis 1. Introduction The most limiting factor for papaya production worldwide is papaya ringspot virus (PRSV), an aphid transmitted potyvirus Papaya (Carica papaya L) is produced commercially in many (Tripathi et al.,2008).In Hawaii,the papaya industry was severely tropical and subtropical areas of the world for domestic consump- damaged by PRSV and production declined from 25.3 million kg in tion and for export.Global papaya production increased about 40%in the early 1990s to 16.1 million kg in the latter part of the decade a single decade(1998-2008),with an estimated 9.1 million tonnes due to virus infection (Gonsalves, 1998; Fuchs and Gonsalves, produced in 2008.The top papaya producing countries are India, 2007). In 1998,two transgenic cultivars with resistance to PRSV Brazil,Nigeria,Indonesia and Mexico(FAO,2010).Papaya is a fruit (Rainbow and SunUp)were released for commercial cultivation in that is well known for its nutritional and medicinal values.In fact, Hawaii.The original transformant(Ro)named 55-1 was obtained the Center for Science in the Public Interest,Washington,DC ranked via particle bombardment of the red-fleshed cultivar Sunset(Ss) papaya in the top 5 (with guava, watermelon, grapefruit and with the transformation vector pGA482GG/cpPRV4 containing the kiwifruit)among 38 common fruits based on nutritional scores and PRSV coat protein (CP)transgene (Ling et al., 1991; Fitch et al., the percentage Recommended Daily Allowance(RDA)for vitamin A, 1992). SunUp (Su) is a red-fleshed cultivar that is essentially a vitamin C,potassium,folate,niacin,thiamine,riboflavin,iron,and transgenic Ss,obtained by selecting progeny of transformant line calcium plus fiber(CSPI,1998). 55-1 that were homozygous for the PRSV CP transgene.Rainbow (Rb)is an F1 hybrid resulting from a cross between the transgenic Su and a yellow-fleshed non-transgenic cultivar, Kapoho (Kp) (Manshardt, 1998; Manshardt, 1999). The development and Corresponding author at:USDA-ARS-Pacific Basin Agricultural Research Center, commercialization of transgenic papaya expressing the PRSV CP 64 Nowelo Street,HI 96720,USA. Tel.:+1 808 932 2100:fax:+1 808 959 5470. gene controlled PRSV and saved the papaya industry in Hawaii E-mail address:dennis.g- (D.Gonsalves). (Tripathi et al.,2008).Since then,transgenic papaya cultivars have 0889-1575/$-see front matter.Published by Elsevier Inc. doi:10.1016/jjfca.2010.07.003 S.Tripathi et al./Journal of Food Composition and Analysis 24(2011)140-147 141 been widely grown in Hawaii with Rb representing the dominant firmness data determined for Rb fruit. Stage 1 (color break) fruit cultivar, accounting for more than 70% of the papaya acreage are characterized by a dark yellowish-green peel color averaging (NASS,2008). 48.35±1.16 for lightness (L*), 32.65±0.83 for chroma (C*), and Although a major constraint to papaya production in Hawaii 121.45±0.88 for hue angle (H°). The peel firmness of color break was eliminated with the introduction of PRSV-resistant plants,the fruit averages 90.8 N±2.9. Stage 2 fruit (ripened off of the tree) papaya industry still faces some challenges in bringing these have peel colors that are a bright, vivid yellow (L*=68.52±0.40, transgenic papaya to market outside the US.Japan and Canada are C*=62.95±0.56,and H°=88.08±0.55),and peel firmness averaging large export markets for Hawaii's papaya. Canada approved the 17.5±0.71 N.Stage 3 fruit(ripened on the tree)also have bright yellow importation of Su and Rb in 2003 (Health-Canada, 2003), and peels(L*=70.03±038,C*=65.66±0.62,and H°=84.48±0.44),but transgenic papaya shipments to Canada are continuing. On the the peel firmness(13.61 ±0.61 N)is lower than stage 2 fruit. other hand,the application for deregulation of transgenic papaya in Japan is ongoing,and reached a milestone when Japan's Ministry 2.3. Sample preparation of Health,Labor and Welfare(MHLW)approved the food safety of the transgenic papaya in May 2009(http://www.fsc.go.jp/sonota/ A total of 32 fruit were collected for each ripening stage of Rb kikansi/21gou/21 gou_1_8.pdf). and another 32 fruit were collected from each ripening stage of the One area of concern for regulatory authorities in Japan was the non-transgenic papaya,Hyb.Individual fruit weight and size were possibility of the introduction or alteration of allergenic proteins in measured. From the 32 fruit of each stage/cultivar type, four transgenic papaya,and changes in the nutritional composition of composite samples were created, each comprised of eight fruits the fruit. Papain and benzyl isothiocyanate (BITC) are the main (Fig. 1).Therefore,compositional analyses were conducted on a total components in papaya with potential allergenic or toxic proper- of 24 composite samples[12 composite samples of Rb(3 stages x 4 ties. The present investigation compares the levels of major composites/stage)and 12 composite samples of non-transgenic Hyb nutritional components including papain and BITC in Rb papaya (3 stages x 4 composites/stage)]. with those of a closely related,non-transgenic commercial papaya To prepare composite samples, individual fruit were cut variety at different stages of fruit ripening. longitudinally and the seed, placenta tissue and peel (5 mm, measured from the surface of the fruit)were removed.Eight slices 2. Materials and methods of papaya flesh of equal amounts(i.e.100 g),one from each of the eight fruit were homogenized in a blender. About 200 g of each 2.1. Source of papaya fruit homogenized, composite sample was placed in a brown plastic Rb is a F1 hybrid obtained from a cross between transgenic Su Rb Hyb (the transgenic version of Ss),and non-transgenic Kp.Since a non- transgenic hybrid consisting of a cross between non-transgenic Ss and non-transgenic Kp is not commercially grown in Hawaii, a selection (F8 to Flo) derived from a hybrid between the cultivar Sunrise(Sr)and Kp was chosen as a comparable control.Sr is an A inbred sibling selection of Ss and is therefore closely related to Ss. The non-transgenic hybrid selection line(Hyb)produced fruit that had thick, deep orange flesh, a crown at the blossom end of the fruit,and skin freckling that closely resembled the fruits of Rb. The transgenic Rb and the Hyb papaya fruit were collected from the same commercial plantation located near Hilo, Hawaii. The grower managed the papaya field under the guidelines of Hawaii Department of Agriculture's(HDOA)Identity Preservation Protocol (IPP)that insures that the transgenic or non-transgenic identity of B each tree in a field has been checked with a biochemical assay (Camp III, 2003). The selected farm had (a) good agronomic practices for commercial production,(b)papaya trees in the field that were in good health with no virus symptoms, (c) both transgenic and non-transgenic trees of similar age in adjacent fields, and (d) plantings of a selection of non-transgenic papaya that shares a similar pedigree with Rb. 2.2. Fruit sampling C Papayas are typically harvested at the color break to 1/8 ripe "a stages for commercial markets.For nutritional comparison,fruit of Rb and Hyb were harvested or treated to obtain three stages of fruit maturity or ripeness:for stage 1,fruits were harvested at color break Fig.1.Different ripeness stages of fruit from transgenic Rainbow(Rb)and non- (mature green fruit)and processed immediately;for stage 2,fruits ten (H . fruit samples were collected for each stage per cultivar.ransg vi The yb)three varieties different A total stages of 32 are designated as:(A)mature green/color were harvested at color break and allowed to fully ripen at 20°C break stage(stage 1),fully developed fruits with dark green skin color(1/8 ripe), to full yellow color(ripened off of the tree)before processing;and which contain the fully developed black seed and ripen when stored at 20°C for 9 stage 3, tree-ripened fruit were harvested at full color (ripened days,(B)ripen at 20°C(stage 2),the fruit harvested at mature green stage and on the tree) and processed immediately (Fig. 1). Ripening stage allowed to fully ripen at 20°c for 9 days,which developed the yellow color and was assessed visually according to commercial practices followed ready-to-eat pulp,and(C)tree ripened(stage 3),a fully ripe papaya fruit with yellow skin color and ready-to-eat pulp. Stage (B) is the normal stage for by the Hawaiian Papaya Industry (HPIA, 2010). The ripening commercial markets.(For interpretation of the references to color in this figure stages correspond in general to the following color index and legend,the reader is referred to the web version of the article.) 142 S.Tripathi et al./Journal of Food Composition and Analysis 24(2011)140-147 bottle arid frozen at—80°C.The set of 24 homogenized composite papaya samples was 0.08 ppm. The precision of the assay was samples was done in triplicate. One set was used for nutritional determined with internal standards having a mean±SD of analyses,the second was used for papain analysis,and the third set 2.04 ppm±0.13,and relative standard deviation(RSD)=6.4%(n=10). was used for BITC analysis. 2.6. Nutritional analyses 2.4. Papain analysis All analyses in this section were conducted by NP Analytical The papain content of papaya fruit at the various ripening Labs (St. Louis, MO.) using standard methodologies. Frozen stages was determined by an indirect ELISA technique. A 0.25 g homogenized papaya samples were sent by air-freight to NP composite sample was homogenized in 7.5 mL of 0.1 M carbonate/ Analytical Labs and remained frozen during shipment. bicarbonate buffer (pH 9.6). The ELISA plate was coated with 200µL of the homogenized extract and incubated overnight at 2.6.1. Moisture 4°C.The analysis was performed by the standard ELISA protocol Fruit moisture content was determined by gravimetric mea- using a polyclonal antibody raised against papain (Abcam Inc., surement of weight loss after drying the samples in a vacuum oven Cambridge,MA).Detection was performed by monitoring the color at 70°C until constant weight was obtained. reaction resulting from the use of alkaline phosphatase conjugated anti IgG antibody (Abcam Inc., Cambridge, MA), as secondary 2.6.2. Protein antibody, and the substrate p-nitrophenyl phosphate (Sigma, St. Total nitrogen content was determined by the Kjeldahl method Louis,MO).ELISA readings were taken at 405 nm wavelength with (AOAC,1995)using an autoanalyzer(Alpken RFA-300,01 Analyti- an MRX plate reader(Dynatech Laboratories, Chantilly,VA).The cal, College Station, TX). Protein was calculated as Kjeldahl amount of papain in fruit samples was calculated by a regression nitrogen x 6.25. The protein assay had a high level of reproduc- (sigmoidal) equation, formulated based on standard curves ibility with a mean±SD of 21.72±0.16%and RSD=0.74% (n=80 generated in this experiment. internal controls). A standard curve was created with known amounts of papain (from 0.5 ng/pi to 3 ng/µL)standard(Sigma,St.Louis,MO)against 2.6.3. Fat analysis ELISA 40.5 nm reading values.Using the papain standard,the lower For total fat analysis, samples were hydrolyzed with hydro- limit of detection was 1 ng/µL. The precision of the assay was chloric acid (GFS Chemical, Powell, OH), and the digest was determined with the standards having a mean+SD of 2.04 ng/ extracted repeatedly with ethyl ether and petroleum ether(AOAC, µL±0.08 and a relative standard deviation(RDS)=4.0%(n=3).The 1995). The solvents were volatilized, and the extracted fat was formula to calculate the level of papain in fruit samples was: dried,weighed and quantified as percent fat. [—b In(a/E—1)+xo] 2.6.4. Fiber Amount of papain in mg/g F of papaya= W Fiber was determined by grinding the dried samples to pass a [150/1000] 1.0 mm screen, and extracting with ether to remove excess fat. where,b =0.3091;a=0.9488;E=ELISA405 nm values;xo=1.6716; Samples were then digested in dilute sulfuric acid, filtered, FW=fresh weight. digested in dilute sodium hydroxide (Fisher Scientific, Pittsburg, PA),and filtered again.The residue was washed, dried,weighed, 2.5. Benzyl isothiocyanate(BITC)analysis ignited, and reweighed. Fiber was calculated from the loss on ignition of the residue (AOAC, 1995). The reproducibility of the BITC levels were measured in papaya fruit based on a method fiber analysis was determined with internal controls (n=80) described by Tang(1971),with modification. For each composite having a mean+SD of 3.19%±0.22,RSD=7%. sample, 1.0 g of tissue was homogenized with 10 mL water, and 200µL of crude papaya thioglucosidase enzyme extract.Thioglu- 2.6.5. Ash cosidase was added to ensure that BITC generation was not limited Ash content was determined by gravimetric measurement of by insufficient enzyme in the reaction mixture.The crude enzyme the sample residue after ignition in a muffle furnace at 500°C.The extract was obtained by rupturing the sarcotestae of 2 g of fresh residue was calculated as percent ash. papaya seed and collecting the fluid contents in 1 mL water without breaking the actual seeds. Homogenates were incubated at 4°C 2.6.6. Carbohydrates for 1 h, extracted with 10 mL of chloroform, and centrifuged Carbohydrates were calculated by subtracting the sum of at 2000 rpm for 40 min. A 5 mL aliquot of the supernatant was protein,fat,moisture,and ash from 100%. removed, placed into glass vials, and the chloroform (Fisher Scientific, Pittsburgh, PA) was evaporated under nitrogen gas. 2.6.7. Vitamin A(/3-carotene and a-carotene) Samples were re-suspended in 100µL chloroform for BITC analysis, Papaya samples were extracted and analyzed for (3-carotene and 100µL of internal standard[(60 ppm octadecane in methylene and a-carotene concentrations using the methods of Bushway et chloride)(Fisher Scientific,Pittsburgh,PA)]was added to account for al. (1985)and Quakenbush and Smallidge (1986). Samples were GC loading variation. Samples (1 µL) were injected into a gas saponified by refluxing in alcoholic potassium hydroxide solution chromatograph(GC-14B,Shimadzu,Columbia,MD)equipped with a (NP Analytical Lab,St.Louis,MO).Carotenes were extracted with flame ionization detector and a capillary column (Agilent J & W hexane (Fisher Scientific, Pittsburgh, PA), evaporated to dryness, Scientific DB-5,0.25µm x 30 m,Agilent Technologies,Santa Clara, and re-suspended in chloroform/methanol (Fisher scientific, CA). The GC conditions were: injector temperature at 250°C, Pittsburgh, PA). Samples were injected into a Beckman System detector temperature at 280°C,and oven temperature at 140°C for Gold high pressure liquid chromatograph(HPLC,Beckman Coulter, 1 min then programmed to increase at a rate of 12°C/min to 280°C. Brea, CA) for separation through a C18 reverse phase column Helium was the carrier gas at a flow rate of 1 mL/min.Hydrogen and (Vydac TP20154,25 cm x 4.6 mm ID;Alltech Assoc.,Deerfield,IL), air for the flame ionization detector were set at 30 mL/min flow with methanol:chloroform (90:10, v/v) as the mobile phase at a rates.Calibration curves were developed using authentic standards flow rate of 1 mL/min.Individual carotenes were detected with a of BITC (Sigma, St. Louis, MO).The quantitation limit for BITC in visible wavelength detector set at 475 nm(Bushway et al.,1985; S.Tripathi et al./Journal of Food Composition and Analysis 24(2011)140-147 143 Quakenbush and Smallidge, 1986). fl-Carotene and a-carotene reproducibility(%RSD;n=80)of ICP analysis ranged from 5.4%for were quantified from standards (Fluka, St. Louis, MO) of known calcium to 12.8% for potassium, with the majority of minerals concentration.The analysis was repeated 32 times with internal having RSD values of 5-7%. controls to determine reproducibility, and the mean±SD for carotenes was 7919±1124 Ul A/100 g,RSD=14%. 2.7. Statistical analysis 2.6.8. Vitamin C Data from each fruit physical measurement,nutrient analysis, Total vitamin C was measured using fluorometric determination papain analysis and BITC analysis were subjected to analysis of (AOAC,2000; Egberg et al., 1975).Ascorbic acid and dehydroas- variance(ANOVA)using the best fit linear models procedure of JMP corbic acid were extracted from 10 g samples with a solution of statistical analysis software package (JMP, 2007). Each analysis metaphosphoric acid/methanol/water. Norit (Fisher Scientific, was conducted using a two-way full factorial design ANOVA (2 Pittsburgh, PA) was added to remove colored interferences from cultivars x 3 ripeness stages) with four replications for each the sample extracts and to oxidize ascorbic acid to dehydroascorbic treatment.A replication consisted of a composite sample of eight acid in the samples and standards(Fluka,St.Louis,MO).The extracts papaya fruit.The Tukey HSD Test,at a=0.05,was used to test for were filtered,and vitamin C was quantified using a rapid flow system differences in groups means(JMP,2007). (Alpkem RFA-300 system, 01 Analytical, College Station, TX). Aliquots of the sample solutions and standards were buffered 3. Results and discussion and reacted with o-phenylenediamine (Sigma, St. Louis, MO), forming quinoxaline-1-one,a fluorescent condensation product of 3.1. Fruit sampling dehydroascorbic acid and o-phenylenediamine. Background or interfering fluorescence was measured by reacting aliquots of the The fruit samples of both Rb and Hyb cultivars ranged from 493 sample and standard solutions with boric acid (Fisher Scientific, to 583 g in weight, 13.6-14.3 cm in length,and 29-30 cm in girth Pittsburgh,PA),which complexes dehydroascorbic acid,preventing among the different stages of fruit ripening(Table 1).Although the the condensation with o-phenylenediamine. Sample fluorescence physical measurements were variable taking all fruits into account, values were corrected for background interference and the samples more uniformity was observed among samples of Rb and Hyb at were quantified from standards (Fluka, St. Louis, MO) of known comparable stages of ripenness.Fruit weight,length and girth of Rb concentration.Repeated analyses of samples with internal controls were not statistically different from that of non-transgenic control (n=80)showed a mean value of 110.5 mg/100 g±8.8,RSD=8%. papaya at comparable stages.The results of PCR analysis confirmed that all trees that were sources of the Rb fruit were positive for the 2.6.9. Vitamin E PRSV CP transgene,whereas trees that were sources of the non- Samples were extracted and saponified with ethanolic 60% transgenic Hyb fruit were negative for the PRSV CP transgene(data potassium hydroxide (NP Analytical Lab, St. Louis, MO) in the not shown).For commercial markets,fruit are normally harvested presence of 6% pyrogallol (Sigma, St Louis, MO) in a 70°C water at color break and allowed to fully ripen(Fig. 1).In both papaya bath according to the methods of McMurray et al.(1980).Extracts varieties, fruits that were harvested at color break ripened fully were partitioned 3 times into hexane, evaporated to dryness in after about nine days at 20°C. rotary evaporator, resuspended in methanol (Fisher Scientific, Pittsburgh, PA), and analyzed by HPLC (Beckman System Gold, 3.2. Nutritional composition analysis Beckman Coulter,Brea,CA)using fluorescence detection(290 nm excitation and 320 nm emission).Samples (25 ILL)were injected 3.2.1. Macronutrients onto a Zorbax ODS column(25 cm x 4.6 mm ID;Agilent Technol- The macronutrient concentrations for transgenic Rb fruit in ogies, Santa Clara, CA), with a mobile phase of methanol:water comparison with the non-transgenic Hyb control are shown at (95:5, v/v) at a flow rate of 3 mL/min. Vitamin E results were the three stages of ripening in Table 2. As expected, moisture reported as mg of a-tocopherol acetate. The detection limit for content decreased and carbohydrates increased significantly in a-tocopherol was 0.4 mg/100 g.The reproducibility of the analysis ripe fruit. Rb fruit lost 2.7% moisture and increased 2% in was determined with internal controls(n=80)having a mean of carbohydrate content from the color break to fully ripened stages. 16.8 mg/100 g±1.15,RSD=6.8%. A similar trend was observed for the Hyb fruit,and differences in macronutrients between ripened fruits of Rb and Hyb were 2.6.10. Minerals insignificant(P>0.05).A decrease in moisture and an increase in Mineral analysis was performed using inductively coupled carbohydrate level as papaya fruit ripen were also reported by plasma-atomic emission spectrometry (ICP-AES) (Varian Vista, Roberts et al.(2008). Varian,Palo Alto,CA).Prior to ICP-AES analysis,fruit samples were The protein analysis was important in this study because the ached in a muffle furnace at 500°C and acid-extracted (AOAC, ratio of new protein (due possibly to protein expressed from 2000).Mineral concentrations were determined by comparing the the transgene) to total papaya protein content was not known. emission of the samples to the emissions of standard solutions.The The protein content in Rb was not elevated when compared to Table 1 Physical measurements for transgenic Rainbow(Rb)and non-transgenic hybrid line(Hyb)papaya fruit used for various nutritional analyses'. Papaya cultivars and fruit maturity stages tested Mature green fruit(stage 1) Fruit ripened off the tree(stage 2) Fruit ripened on the tree(stage 3) Transgenic(Rb) Non-transgenic(Hyb) Transgenic(Rb) Non-transgenic(Hyb) Transgenic(Rb) Non-transgenic(Hyb) Fresh weight(g) 493.2±66.3` 544.6±80.9a"° 516.8±72.6b` 533.8±111.0'6` 578.2±67.4'b 583.3±126.2' Length(cm) 13.6±0.9'6 14.0±0.9°b 14.3±0.76 14.3±1.4'6 13.6±0.7' 13.9±1.1' Girth(cm) 28.6±1.66 29.9±1.6'b 30.2±1.7'b 30.2±2.3'b 29.2±1.5' 29.6±2.0' Values shown in the table are the mean of 32 papaya fruits,mean±SD. Means within the same row followed by the same letters are not significantly different at the a=0.05 level,based on a Tukey HSD test for mean separation. 144 S.Tripathi et al./Journal of Food Composition and Analysis 24(2011)140-147 Table 2 Macronutrient,vitamin A and vitamin C composition of transgenic Rainbow(Rb)and non-transgenic hybrid line(Hyb)papaya fruits at different stages of ripening`. Papaya cultivars and fruit maturity stages tested Mature green fruit(stage 1) Fruit ripened off the tree(stage 2) Fruit ripened on the tree(stage 3) Transgenic(Rb) Non-transgenic(Hyb) Transgenic(Rb) Non-transgenic(Hyb) Transgenic(Rb) Non-transgenic(Hyb) Moisture(g/100g) 87.1±0.3ab 87.7+0.7' 86.1±0.1'1 86.6±0.21c 85.0±0.1` 85.5±0.2de Protein(g/100g) 0.743±0.05b 0.831±0.03a 0.843±0.01' 0.829±0.04' 0.779±0.06'b 0.702±0.01b Fat(g/100g)' <0.100 0.157±0.05 0.171+0.02 0.169±0.003 0.158+0.07 0.141±0.00 Fiber(g/100g) 0.632+0.06' 0.631±0.06' 0.560±0.05ab 0.576±0.04ab 0.490±0.09b 0.535±0.04ab Ash(g/100g) 0.437±0.02a' 0.460±0.03' 0.388+0.04ab 0.364±0.06b 0.445±0.03' 0.410±0.01ab Energy(kJ/100g) 209.3±4.6de 200.5±11.7e 229.0±5.0b` 219.8±4.6`d 245.3±2.5' 236.6±4.6a' Vitamin A(IUA/100g) 105±9.6'd 50.3±5.6` 156±6.8b 87.6±29.6de 262±18.2' 138±18.66' Vitamin C(mg/100g) 57.4±1.6`d 46.3±7.9d 68.3±13.06' 65.8±2.66` 84.9±2.7' 75.9±3.5a' ' Values shown in the table are the mean of four composite samples consisting of 32 papaya fruits,mean±SD.All values were calculated based on fresh weight basis. ' Statistical analysis was not performed because of insufficient replicates. Means within the same row followed by the same letters are not significantly different at the a=0.05 level,based on a Tukey HSD test for mean separation. non-transgenic Hyb papaya at different fruit ripening stages(Table vitamin A concentrations than either Kp or Su cultivars;our results 2). Rather, a lower protein content was observed in Rb when confirmed this observation. A similar trend was also reported compared to Hyb at the color break stage, and this difference between transgenic and non-transgenic control fruit by Roberts et subsequently became insignificant at the fully ripened stage. All al. (2008). Differences between Rb and Hyb reported here could other macronutrients were not significantly different between Rb also be attributed to varietal differences, or possibly, to subtle and Hyb (P>0.05) at their various comparable stages of fruit differences in the age of harvested fruit. Although papaya were ripening. In general,the macronutrient levels (moisture, protein, harvested at stages designated as color break or fully ripened,even fat,carbohydrate,fiber,ash)in Rb papaya were within the range of slight variability in maturity and ripening at these stages could the non-transgenic control and were similar to earlier published potentially contribute to a wide range of differences in vitamin A reports(Roberts et al.,2008; USDA,2008; Wall,2006). levels.Indeed,while the vitamin A contents of Rb reported in this study agree in general with the vitamin content of papaya in other 3.2.2. Vitamins published reports (Kimura et al., 1991; Philip and Chen, 1988; All tested vitamin contents in papaya fruits of transgenic Rb Roberts et al.,2008; USDA,2008; Wall,2006)other studies have and non-transgenic Hyb are summarized in Table 2. Vitamin E reported that vitamin A(or carotenoids)levels in papaya fruit are (a-tocopherol acetate) content was below the detection limit highly variable between and within cultivars.Our data indicated (<0.4 mg/100 g) for all of the samples.Vitamin A and vitamin C differences in vitamin A level between Rb and the non-transgenic increased significantly as fruits ripened,with the highest contents Hyb of up to 1.9-fold.This observation is not surprising considering measured in tree-ripened fruit.The highest vitamin A concentra- the even greater variability reported in other published data. For tions(based on(3-carotene)for Rb and Hyb fruit ripened on the tree example,variations in vitamin A levels of up to 5.7-fold between were 2621U/100 g fresh weight (FW) and 1381U/100 g FW, papaya cultivars have been reported (Chandrika et al., 2003; respectively. Vitamin C content was highest for Rb (84.9 mg/ Gouado et al.,2007;Wall,2006;Yano et al.,2005).Variations in 100 g FW), compared to the non-transgenic Hyb (75.9 mg/100 g vitamin A levels of up to 3.9-fold also were reported within a single FW)for tree-ripened papayas.The changes in vitamin contents for papaya variety(Sr),and a 1.6-fold variation was reported among Rb followed a similar trend for Hyb among the different ripening Rb fruit(Wall,2006).Considering the high variability in vitamin A treatments.However,vitamin A was significantly higher in Rb fruit levels reported for papaya,the greater level of vitamin A in Rb as at all stages of ripening (P>0.05), whereas the differences in compared to Hyb does not appear to be related to an effect of the vitamin C content between Rb and Hyb were insignificant. transgene. This observation is also supported by the results The attractive color of papaya is due to the presence of published by Mutsuga et al.(2001)where differences in the total carotenoids which make papaya a rich source of vitamin A(Cano et carotenoid content between Su and Ss papaya were statistically al., 1996). According to Wall (2006), Rb tends to have higher insignificant. Table 3 Mineral contents in transgenic Rainbow(Rb)and non-transgenic hybrid line(Hyb)papaya fruits at different stages of ripening`. Minerals(mg/100g fresh weight) Papaya cultivars and fruit maturity stages tested Mature green fruit(stage 1) Fruit ripened off the tree(stage 2) Fruit ripened on the tree(stage 3) Transgenic(Rb) Non-transgenic(Hyb) Transgenic(Rb) Non-transgenic(Hyb) Transgenic(Rb) Non-transgenic(Hyb) Macroelements Calcium 14.7±1.84b' 23.9+1.59' 11.9±1.92` 21.3+4.53' 9.51+0.86` 19.6±2.41ab Magnesium 20.8±1.49' 18.7±0.92a' 19.1±2.85a1 19.8±2.85ab 15.9±1.74b 17.4±2.03a1 Phosphorus 6.58±0.48 ' 6.88±0.83' 5.07±0.20` 5.57±0.171c 6.20±0.46'b 6.30±0.49a' Potassium 166+14.7' 133±22.2a1 138±6.61a1 122±4.1b 162±l8.8a' 135±25.4a1 Sodium 2.86±0.19a1 3.17±0.31' 2.34±0.29b 2.81±O.24a6 2.51±0.43'b 2.69±0.47a' Microelements Copper 0.06±0.004' 0.05±0.02a6 0.02±0.003` 0.03±0.021c 0.04±0.004'b 0.04±0.005'1c Iron 0.07±0.03' 0.08±0.07' 0.05±0.04' 0.07±0.03a 0.07±0.004' 0.08+0.02' Manganese 0.02±0.002' 0.01±0.004a6 0.01±0.0021c 0.01+0.002` 0.01±0.002'b 0.01±0.0021` Zinc 0.04±0.006' 0.06+0.02' 0.03±0.01' 0.04±0.008' 0.05±0.005' 0.07±0.03' ' Values shown in the table are the mean of four composite samples consisting of 32 papaya fruits,mean±SD. Means within the same row followed by the same letters are not significantly different at the a=0.05 level,based on a Tukey HSD test for mean separation. S.Tripathi et at/Journal of Food Composition and Analysis 24(2011)140-147 145 Table 4 Contents of papain and benzyl isothiocyanate(BITC)in transgenic Rainbow(Rb)and non-transgenic hybrid line(Hyb)papaya=. Contents(mg/100g of fresh weight) Papaya cultivars and fruit maturity stages tested Mature green fruit(stage 1) Fruit ripened off the tree(stage 2) Fruit ripened on the tree(stage 3) Transgenic(Rb) Non-transgenic(Hyb) Transgenic(Rb) Non-transgenic(Hyb) Transgenic(Rb) Non-transgenic(Hyb) Papain 8.60±1.06' 6.41±0.24b 5.86±0.186 5.55±0.34b 5.81 t0.09b 5.43±0.226 BITC 0.040±0.03' 0.056±0.04' 0.041±0.02' 0.042±0.02' 0.061±0.02' 0.057±0.06' Values shown in the table are the mean of four composite samples consisting of 32 papaya fruits,mean±SD. Means within the same row followed by the same letters are not significantly different at the a=0.05 level,based on a Tukey HSD test for mean separation. The average vitamin C content in ripe papaya fruits in this study 4).Papain was highest(8.60 mg/100 g FW)in mature green fruit of was slightly greater than the vitamin C level reported by Wall Rb and gradually declined by up to 32%as the fruit ripened.A similar (2006)and in the USDA Nutrient Database(2008), and generally downward trend was observed in the ripening fruit of Hyb. This agrees with other published vitamin C data (Franke et al.,2004; decrease in papain levels was reported earlier for papaya(Azarkan Nisperos-Carriedo et al., 1992). The vitamin C concentrations et al.,2003;Mezhlumyan et al.,2003).It was reported that papain increased as the fruit approached ripeness, with the highest levels were lowest at the initial stages of fruit development (i.e. contents recorded when fruit were harvested at full color from the immature green fruits) and gradually increased when fruit tree (ripened on the tree). Vitamin C levels are affected by the approached maturity (i.e. mature green) (Madrigal et al., 1980; amount and intensity of sunlight exposure to individual fruit. Skelton,1969).Papain levels were reported to be highest when fruits Longer day lengths and higher light intensities in the summer were fully developed (i.e. mature green) and later gradually months,for example,can increase the concentrations of ascorbic decreased again as the fruit approached ripeness (Skelton, 1969). acid and glucose in fruits(Lee and Kader,2000; Mozafar, 1994). The papain level in mature green fruit of Rb was significantly higher than the Hyb fruit,however,these differences became insignificant 3.2.3. Minerals as the fruit ripened (Table 4). Papain levels were highly variable Mineral analysis of Rb and Hyb papaya showed a slight within papaya cultivars,locations,and sampling methods in reports decreasing trend for Ca, P, Na, and Cu as fruit reached full color by others(Balamohan et al.,2008;Harjadi et al.,1995;Kunkalikar et from the color break stage (Table 3). Other minerals showed no al.,2007). obvious pattern of change as fruit approached full color.The levels In some countries such as Thailand, green papaya which of Ca,Mg,Cu and Zn are slightly greater and the K is lower in Rb contains higher level of papain as compared to ripe papaya is papaya than those reported in the USDA Nutrient Database(2008) consumed. However, a dietary value for papain has not been for Solo papaya. However, the mineral levels in Rb papaya were established. NIH Dietary Supplements Labels Database listed 81 within the range reported in other studies (Bari et al., 2006; dietary supplements available in the market which contain papain Roberts et al.,2008;Wall,2006;Wenkam, 1990). at levels as high as 130 mg/serving(NIH,2009).Green mature fruit Among all the minerals analyzed for Rb, only calcium was of transgenic Rb papaya on the other hand contain only 8.60 mg of noted to be significantly different from Hyb,but was within the papain per 100 g FW of papaya.Therefore,a person consuming a range of reported values for papaya(Bari et al.,2006;Roberts et al., 100 g serving of green Rb papaya would intake only 8.6 mg of 2008; Wall, 2006; Wenkam, 1990). A similar observation was papain which is much lower than the papain found in most of the reported by Roberts et al.(2008)where the calcium contents of dietary supplements consumed by humans. Thus, although the the control were significantly different from the transgenic line. papain content in mature green fruit of Rb is higher compared to Mineral composition is dependent on several environmental that of the non-transgenic control,it is still at a level that does not factors and tends to reflect the mineral content of a location and seem to pose any threat to human consumption. region.The conditions of the root system of the host plant are known to affect the levels of minerals (Baldwin, 1975). The 3.4. Benzyl isothiocyanate(BITC) transgenic Rb and non-transgenic Hyb were grown in the same orchard under identical fertility practices,and the results indicate BITC is a volatile compound naturally found in many fruits and that mineral content of the two cultivars were not statistically vegetables. A higher level of BITC is present in papaya seed as different. compared to papaya pulp (Ettlinger and Hodgkins, 1956; Tang, 1971).Papaya fruit at the unripe,immature green stage generally 3.3. Papain contain a higher level of BITC than that observed in ripened fruits (Tang, 1971). The BITC levels of individual samples ranged from Papain is one of the cysteine endopeptidases found in the latex 0.014 to 0.084 mg and from 0.010 to 0.150 mg/100 g FW in Rb and of a wide range of plants including papaya, where it composes Hyb papaya fruit, respectively, and averaged 0.040-0.061 mg/ up to 80% of the latex (El Moussaoui et al., 2001). Latex is a 100 g FW of papaya (Table 4). No significant differences were complex mixture of chemical compounds with important detected(P>0.05)in BITC content between transgenic and non- proteolytic activity and is believed to be involved in defending transgenic papaya fruit. the host plant from various insect pests.Papain is considered to be The changes in BITC level between mature green/color break a possible cause of allergenic reactions in humans, because fruit and ripe fruit were statistically insignificant(P>0.05) and allergenicity is known to be associated with cysteine proteases within the range of other published reports for papaya(Roberts et (Chambers et a1.,1998).Therefore,the papain level in Rb fruit was al., 2008; Tang, 1971). Isothiocyanate concentrations in ripe Rb compared with the non-transgenic Hyb fruit to determine fruits were about 1000 times lower than the values reported in whether the papain levels were altered by the process of genetic other crops,particularly in Brassica(Josefsson,1967).The level of modification. BITC in Rb papaya was not altered by the transgene and was within Mean papain values of Rb and Hyb fruit ranged from 5.81 to the range found in other papaya and thus poses no special concern 8.60 mg/100 g FW and 5.43-6.41 mg/100 g FW,respectively(Table for human health. • 146 S.Tripathi et al./Journal of Food Composition and Analysis 24(2011)140-147 4. Conclusions Codex Alimentarius Commission,2003.Codex principles and guidelines on foods derived from biotechnology.Codex Alimentarius Commission,Joint FAO/WHO Food Standard programme. Food and Agriculture Organization of United As part of food safety requirements for Japan's deregulation Nations,Rome,Italy. measures,a comprehensive study comparing transgenic Rb with a cSPI,1998.Fresh Food Comparison:Fantastic Fruit.Nutrition Action Healthletter, non-transgenic cultivar of similar pedigree showed that the Center for Science in the Public Interest.Retrieved from:http://cspinet.org/nah/ fantfruit.htm. contents of nutrients,papain and BITC of the two varieties were Egberg,D.C.,Potter,R.H.,Heroff,J.H.,1975.Semiautomated method for the fluoro- the same, except for calcium and vitamin A. Plant-to-plant metric determination of total vitamin C in food products. Journal of the variation even within a particular papaya cultivar grown under Association of Official Analytical Chemists 60,126-131. El Moussaoui,A.,Nijs,M.,Paul,C.,Wintjens,R.,Vincentelli,J.,Azarkan,M.,Looze,Y., the same conditions is common and could possibly explain this 2001.Revisiting the enzymes stored in the laticifers of Carica papaya in the variation observed between Rb and the non-transgenic control. context of their possible participation in the plant defense mechanism.Cellular However,the differences identified between transgenic Rb and the and Molecular Life Sciences(CMLS)58,556-570. non transgenic control in calcium and vitamin A were small,and Ettlinger,M.G.,Hodgkins,J.E.,1956.The mustard oil of papaya seed.The Journal of Organic Chemistry 21,204-205. along with the values of other tested components at various FAO,2010.FAO Statistics Database 2010(FAOSTAT).Food and Agriculture Organi- ripening stages in Rb papaya,were within the ranges previously zation.Retrieved from the FAOSTAT home page:http://faostat.fao.org/ reported for papaya(Roberts et al.,2008;USDA,2008;Wall,2006). FAO/WHO,1996.Biotechnology and Food Safety.Report of Joint FAO/WHO Con- sultation.FAO Food and Nutrition paper 61.Food and Agriculture Organization Compositional analysis is one of the important aspects assessed in of United Nations,Rome,Italy. determining substantial equivalence,a criterion used internation- FAO/WHO,2000.Safety aspects of genetically modified foods of plant origin.Report ally for risk assessment of transgenic food.Substantial equivalence of a Joint FAO/WHO Expert Consultation on Foods Derived from Biotechnology. Geneva,Switzerland. Food and Agriculture Organization of United Nations, refers to the finding of insignificant differences between two or Rome,Italy. more compared goods or products(Codex Alimentarius Commis- FAO/WHO,2002.Allergencity of genetically modified foods.Report of the Third Sion,2003; FAO/WHO, 1996,2000,2002; OECD, 1993). Session of the Codex Ad Hoc Intergovernmental task Force on Food Derived from Biotechnology(ALINORM 01/34).Food and Agriculture Organization of In addition to this study, molecular characterization of the United Nations,Rome,Italy. transgene insertion in the Rb or Su papaya genome and analysis of Fitch,M.M.M.,Manshardt,R.M.,Gonsalves,D.,Slightom,J.L.,Sanford,J.C.,1992. the whole Su papaya genome sequence showed that transgenesis Virus resistant papaya plants derived from tissues bombarded with the coat protein gene of papaya ringspot virus.Nature Biotechnology 10,1466-1472. did not disrupt the function of any papaya genes(Ming et al.,2008; Franke,A.A.,Custer,LJ.,Arakaki,C.,Murphy,S.P.,2004.Vitamin C and flavonoid Suzuki et al.,2008).Collectively,these data make Rb papaya the levels of fruits and vegetables consumed in Hawaii.Journal of Food Composition most extensively characterized transgenic tropical fruit crop. and Analysis 17,1-35. Although Rb papaya has been widely consumed since 1998 Fuchs, M., Gonsalves, G., 2007. Safety of virus-resistant transgenic plants two decades after their introduction: lesson from realistic field risk assessment without any reported adverse health effects, to date, Rb and Su studies.Annual Review of Phytopathology 47,173-202. remain the first and only widely commercially cultivated Gonsalves, D., 1998. Control of papaya ringspot virus in papaya: a case study. transgenic Annual Review of Phytopathology 36,415-437. g papaya varieties. Several other laboratories have Gouado,I.,Ejoh,R.A.,Issa,T.S.,Schweigert,F.J.,Tchouanguep,M.F.,2007.Carote- reported developing transgenic papaya resistant to PRSV.Howev- noids content of some locally consumed fruits and yams in Cameroon.Pakistan er, apart from perhaps few exceptions, these transgenic plants Journal of Nutrition 6,497-501. have been restricted to the laboratory and are facing deregulation Harjadi.S.S.,Pribadi,F.I.,Koswara,S.,1995.The effect of K levels on the yield and quality of fruit and crude papain from 3 papaya cultivars.Acta Horticulturae challenges,a major hurdle that limits them from benefiting small 379,83-88. farmers and industry. Health-Canada,2003.Virus resistant transgenic papaya line 55-1.In:Novel Food Decision,Approved Products, Health Canada,Canada.Retrieved October 08, References 2009 from:htt p://www.hc-sc.gc.ca/fn-an/gmf-agm/appro/index-eng.php. HPIA,2010.Hawaii Papaya Industry Association,PAPAYA INFO.Retrieved July 07, 2010 from:http://www.hawaiipapaya.com/info.htm. Association of Official Analytical Chemists (AOAC), 1995. Official Methods of JMP,2007.JMP 7.0.2.SAS Institute Inc.,Cary,NC. Analysis, 16th ed.AOAC International,Arlington,VA. Josefsson, E., 1967. Distribution of thioglucosides in different parts of Brassica Association of Official Analytical Chemists (AOAC), 2000. Official Methods of plants.Phytochemistry 6,1617-1627. Analysis, 17th ed.AOAC International,Gaithersburg,MD. Kimura,M.,Rodriguez-Amaya,D.B.,Yokoyama,S.M.,1991.Cultivar differences and Azarkan, M., Moussaoui,A.E.,van-Wuytswinkel, D., Dehon,G., Looze,Y., 2003. geographic effects on the carotenoid composition and vitamin A value of Fractionation and purification of the enzymes stored in the latex of Carica papaya.Lebensmittel-Wissenschaft&Technologie 25,415-418. papaya.Journal of Chromatography B 790,229-238. Kunkalikar,S.,Bayadgi,A.S.,Kulkarni,V.R.,Krishnareddy,M.,2007.Study on papain Balamohan,T.N.,Soorianathasundaram,K.,Jeyakumar,P.,Auxcilia,J.,Srinivasan,N., in papaya ringspot affected papaya.Annals of Biology 23,49-51. Manoranjitham,K.,Nalina,L,Kavino,M.,2008.Papaya-Production Technology. Lee,S.K.,Kader,A.A.,2000.Preharvest and postharvest factors influencing vitamin C Technical Bulletin. Department of Fruit Crops,Horticulture College and Re- content of horticultural crops.Postharvest Biology and Technology 20,207-220. search Institute,Tamil Nadu Agricultural University,Coimbatore,India. Ling, K.,Namba,S.,Gonsalves,C.,Slightom,J.L.,Gonsalves,D., 1991.Protection Baldwin,J.P.,1975.A quantitative analysis of the factors affecting plant nutrients against detrimental effects of potyvirus infection in transgenic tobacco plants uptake from some soils.Journal of Soil Science 26,195-206. expressing the papaya ringspot virus coat protein.Biotechnology 9,752-758. Bari,L,Hassa,P.,Absar,N.,Haque,M.E.,Khuda,M.I.I.E.,Pervin,M.M., et al.,2006. Madrigal,S.L.,Ortiz,N.A.,Cooke,R.D.,Fernandez,H.R.,1980.The dependence of Nutritional analysis of two local varieties of papaya (Carica papaya L) at crude papain yields on different collection(tapping)procedures for papaya different maturation stages.Pakistan Journal of Biological Sciences 9,137-140. latex.Journal of the Science of Food and Agriculture 31,279-285. Bushway,R.J., 1985.Separation of carotenoids in fruits and vegetables by high Manshardt, R.M., 1998.Production requirements of the transgenic papayas 'UH performance liquid chromatography.Journal of Liquid Chromatography 8, Rainbow'and'UH Sunup'.University of Hawaii,College of Tropical Agriculture 1527-1547. and Human Resources.New Plants for Hawaii-2,p.4. Camp III,S.G.,2003.Identity preservation protocol for non-GMO Papayas,Revised Manshardt, R.M., 1999. 'UH Rainbow' papaya. University of Hawaii,College of April 7,2003. In: Gonsalves, D.(Ed.),Virus Resistant Transgenic Papaya in Tropical Agriculture and Human Resources New Plants for Hawaii-1,revised, Hawaii:A Case for Technology Transfer to Lesser Developed Countries.OECD/ p.2. USAID/ARS Conference,October 22-24,2003.Petroglyph Press,Ltd.,Hilo,HI, McMurray,C.H.,Blanchflower,W.J.,Rice,D.A.,1980.Influence of extraction tech- pp.95-100. niques on determination of a-tocopherol in animal feedstuffs. Journal of Cano,M.P.,Ancos,B.D.,Lobo,M.G.,Monreal,M.,1996.Carotenoid pigments and Association of Official Analytical Chemists 63,1258-1261. colour of hermaphrodite and female papaya fruits(Carica papaya L)cv sunrise Mezhlumyan,L.G.,Kasymova,T.D.,Yuldashev,P.K.,2003.Proteinases from Carica during post-harvest ripening.Journal of the Science of Food and Agriculture 71, papaya latex.Chemistry of Natural Compounds 39,223-228. 351-358. Ming,R.,Hou,S.,Feng,Y.,Yu,Q,Dionne-Laporte,A.,Saw,J.H.,et al.,2008.The draft Chambers,L,Brown,A.,Pritchard,D.I.,Sreedharan,S.,Brocklehurst,K.,Kalsheker, genome of the transgenic tropical fruit tree papaya(Carica papaya Linnaeus). N.A., 1998. Enzymatically active papain preferentially induces an allergic Nature 452,991-996. response in mice. Biochemical and Biophysical Research Communications Mozafar, A., 1994. Plant Vitamins: Agronomic, Physiological and Nutritional 253,837-840. Aspects.CRC Press,Boca Raton,FL Chandrika,U.G.,Jansz,E.R.,Wickramasinghe,S.M.D.N.,Warnasuriya,N.D.,2003. Mutsuga, M., Ohta, H., Toyoda, M., Goda, Y., 2001. Comparison of carotenoid Carotenoids in yellow-and red-fleshed papaya(Carica papaya L).Journal of the components between GM and non-GM papaya. Shokuhin Eiseigaku Zasshi Science of Food and Agriculture 83,1279-1282. 42,367-373. S.Tripathi et al./Journal of Food Composition and Analysis 24(2011)140-147 147 NASS,2008.USDA National Agricultural Statistics Service. Retrieved from:http:// Skelton,G.S.,1969.Development of proteolytic enzymes in growing papaya fruit. www.nass.usda.gov/hi. Phytochemistry 8,57-60. NIH,2009.Dietary Supplements Labels Database.US National Library of Medicine, Suzuki,J.Y.,Tripathi,S., Fermin,G.A.,Jan, F.-J., Hou, S.,Saw,J.H., et al., 2008. National Institute of Health.Retrieved September 01,2009 from:http://diet- Characterization of insertion sites in Rainbow papaya,the first commercialized arysupplements.nlm.nih.gov/dietary/. transgenic fruit crop.Tropical Plant Biology 1,293-309. Nisperos-Carriedo,M.O.,Buslig,B.S.,Shaw,P.E.,1992.Simultaneous detection of Tang,C:5.,1971.Benzyl isothiocyanate of papaya fruit.Phytochemistry 10,117-121. dehydroascorbic,ascorbic,and some organic acids in fruits and vegetables by Tripathi,S.,Suzuki,J.Y.,Ferreira,S.A.,Gonsalves,D.,2008.Papaya ringspot virus-P: HPLC.Journal of Agricultural and Food Chemistry 40,1127-1130. characteristics,pathogenicity,sequence variability and control.Molecular Plant OECD,1993.Safety evaluation of foods derived by modern biotechnology,Concepts Pathology 9,269-280. and principles.Organization for Economic Cooperation and Development,Paris, USDA,2008.USDA National Nutrient Database for Standard Reference,Release 21. France. Retrieved August 06, 2009 from the Nutrient Data Laboratory Home Page: Philip,T.,Chen,T.-S., 1988.Quantitative analyses of major carotenoid fatty acid http://www.nal.usda.gov/fnic/foodcomp/search/. esters in fruits by liquid chromatography:persimmon and papaya.Journal of Wall,M.,2006.Ascorbic acid,vitamin A,and mineral composition of banana(Musa Food Science 53,1720-1722. sp.)and papaya(Carica papaya)cultivars grown in Hawaii.Journal of Food Quakenbush,F.W.,Smallidge,R.L.,1986.Nonaqueous reverse phase liquid chro- Composition and Analysis 19,434-445. matographic system for separation and quantitation of vitamin A.Journal of the Wenkam,N.S.,1990.Food of Hawaii and the Pacific Basin,Fruits and Fruit Products: Association of Official Analytical Chemists 69,767-772. Raw,Processed,and Prepared,vol.4:Composition.Hawaii Agricultural Experi- Roberts,M.,Minott,D.,Tennant,P.,Jackson,J.,2008.Assessment of compositional ment Station Research and Extension Series 110,96 pp. changes during ripening of transgenic papaya modified for protection against Yano,M.,Kato,M.,Ikoma,Y.,Kawasaki,A.,Kukazawa,Y.,Sugiura,M.,Matsumoto, papaya ringspot virus.Journal of the Science of Food and Agriculture 88,1911- H.,Oohara,Y.,Nagao,A.,Ogawa,K.,2005.Quantitation of carotenoids in raw 1920. and processed fruits in Japan.Food Science and Technology Research 11,13-18. HORTSCIENCE 45(1):161-164.2010. COUNTY CLERK cinphosphotransferase for kanamycin resis- tance) and uidA [(3-glucoronidase (GUS)] Determining Sex aniPNEitg.niiirtor reporter genes NCBI accession FJ467933 y. (Fitch et al., 1992;Ling et al., 1991). the Adventitious Pr t�B�o� I$= $0 The presence of transgenic papaya plants in Hawaii presents a potential increased risk Transgenic Material in Carica ces etransgenic tt aterial.sAlthou h ce by Although is an ongoing effort to obtain regulatory papaya L. Seed Germplasm clearance in Japan for the importation of the transgenic 55-1 papaya, genetically engi- Trade K.Matsumoto', Francis T.P. Zee,Jon Y. Suzuki, neered papayas cannot be shipped into Japan Savarni Tripathi, and James Carr or the European Union(Ohmori et al.,2008). USDA, ARS, Pacific Basin Agricultural Research Center, Tropical Plant Contamination unintentional na transgenic genetic material or the other unintentional getic outcrossing of the Genetic Resource and Disease Research Unit,P.O.Box 4459,Hilo,HI 96720 germplasm material is of great concern to the Bruce Mackey USDA TPGRDR because we distribute Car- icaceae germplasm to locations throughout the USDA, ARS, Pacific West Area, 800 Buchanan Street, Albany, CA 94710 world.Therefore,to optimize our production, Additional index words. hermaphrodite, female, polymerase chain reaction (PCR), Papaya we developed a polymerase chain reaction (PCR) protocol to test our material for the ringspot virus(PRSV),GUS,papain,GMO detection presence of the transgene and to determine the Abstract.Papaya ringspot virus (PRSV)is a devastating disease that has a detrimental sex of the seedlings planted into the field to impact on both commercial papaya production and Caricaceae germplasm conservation. reduce the labor required to remove the un- In 1998,the PRSV coat protein transgenic line 55-1 and derived progeny were released to desired female plants after flowering. growers in Hawaii.The transgenic varieties have provided durable and practical control Standard operating procedures at the of the disease that have saved the papaya industry.However,like with transgenic crops TPGRDR unit for Caricaceae seed preserva- throughout the world,there is public concern about the possibility of cross-contamination tion include regeneration of seeds every 4 to 6 of these transgenic materials into nontransgenic lines. As the designated germplasm Years depending on the storage viability of repository for Caricaceae, we are responsible for maintaining the genetic integrity of each accession.Papaya seedlings are germi- each accession.Therefore,we have developed a protocol using polymerase chain reaction nated in the same area that they are planted to for detection of the adventitious presence of the 55-1 transgene insertion event in both reduce the chance of introducing PRSV and parental plants and their progeny seed populations.This protocol assures a 99.9%con- other diseases into a new growing area. An fidence level of obtaining seeds that are 99.5%transgene-free.The protocol developed in average of three to five seedlings(depending this study is not typical for most seed validation techniques because there is a higher than on the cultivar)are planted per planting hole normal producer risk resulting from the potential of large numbers of seeds not meeting to ensure the presence of at least one her- the stringent criteria.However,we believe this is necessary to ensure the genetic integrity maphrodite plant for gynodioecious acces- of seeds stored in the repository. sions or one male or one female plant for dioecious accessions.Once flowering occurs, the remaining female or male plants are re- The Caricaceae family consists of six Papaya ringspot virus(PRSV)is a devas- moved. Because the hermaphrodite papayas genera, including Vasconcellea, which con- tating disease that has a detrimental impact in are in-bred, seed production is achieved by tains 21 of the 35 Caricaceae species, and Hawaii on both commercial production and bagging flowers in glassine envelopes before Carica papaya L.,which is the most economi- germplasm conservation.Although tolerance anthesis to prevent outcrossing. For highly cally important species attributable largely to but not genetic resistance to PRSV has been heterozygous, dioecious papaya lines, it is its cultivation in the tropics for fruit pro- reported in the Carica germplasm, PRSV- necessary to gather pollen from all male trees duction (Van Droogenbroeck et al., 2004). resistant plants have been achieved by within the same genetic line to pollinate all Breeding and selection of C.papaya for cul- genetic engineering with the commercial re- the female plants to ensure preservation of tivation has resulted in the development lease of transgenic papaya cultivars SunUp the genetic integrity of the accession.During of numerous C. papaya varieties and this and Rainbow. In 2009, the Hawaii papaya the regeneration cycle,observations on plant comprises the majority of accessions at the industry is based on `Rainbow' (77%), stature and growth characteristics are moni- USDA, ARS, PBARC, Tropical Plant Ge- `Kapoho' (9%), `Sunrise' (9%), and other tored to ensure the consistent phenotypic netic Resources and Disease Research (5%)(USDA,National Agricultural Statistics traits for the genetic line.In addition,papaya (TPGRDR) unit in Hilo, HI. The TPGRDR Service and State of Hawaii Department of fruit morphological data are obtained, sub- is part of the National Plant Germplasm Agriculture Agricultural Development Divi- mitted, and stored in the national plant System and the designated location for Car- sion, 2009). The SunUp' variety is the database system known as the Germplasm icaceae germplasm. homozygous version of the original trans- Resources Information Network (GRIN). genic line 55-1 and 'Rainbow' is the F1 Morphological data on papaya fruit can be hybrid cross between`SunUp'and`Kapoho' obtained at http://www.ars-grin.gov/cgi-bin/ Received for publication 17 Aug.2009.Accepted (reviewed in Gonsalves et al., 2006). The npgs/html/desclist.pl?126. for publication 7 Nov.2009. plasmid used in the generation of the trans- Because genetically engineered plants are We thank Russell Kai, Mariel Mogote,Angelica genic line 55-1 consisted of the Agrobacte- indistinguishable from the original genetic Tangalin,and Tsuyoshi Tsumura for their excellent rium transformation vector pGA482GG/ source with the exception of the transgene,it technical assistance. cpPRV4, which contained 70 bases of the is almost impossible to distinguish the trans- Mention of a trademark, proprietary product, or 5' Cucumber mosaic virus untranslated re- genic and nontransgenic material based only vendor does not constitute a guarantee or warranty gion fused to the 16 amino acid sequence of on morphological characteristics. Thus,var- of the product by the U.S.Department of Agricul- the N-terminal end of the Cauliflower mosaic ious researchers have used PCR techniques ture and does not imply its approval to the exclusion of other products or vendors that also virus coat protein that is translationally fused to detect the presence of the transgene insert may be suitable. to the coat protein of PRSV HA 5-1.Expres- in 55-1 papaya lines in seeds,seedlings,and 'To whom reprint requests should be addressed; sion is controlled by the 35S promoter and fruits(Ohmori et al.,2008;Wall et al.,2004). e-mail tracie.matsumoto @ars.usda.gov. selection was based on the NPTII (neomy- Identification of the transgene inserts from HORTSCIENCE VOL.45(1)JANUARY 2010 161 seeds was based on a homogenous population CTAB, 1.4 M NaCI, 100 mM Tris pH 8.0,20 CGC TCC CCG TCT TA-3',P55 LFR REV 5'- and not a mixture of seeds from transgenic mM EDTA pH 8.0, and 0.1% [3-mercaptoe- GGA ACG AAA ACT CAC GTT AAG GG-3', and nontransgenic sources(Wall et al.,2004). thanol), incubated at 60 °C for 30 min with P55 LFR int REV 5'- TTC TTG AAG CAT Numerous methods have been developed to shaking, extracted with 750µL chloroform: CTA AGG CTG C-3',P55 RB FOR 5'-CAA screen seeds such as maize,canola,soybeans, octanol (24:1), and precipitated with two- AGT TCC GTC ACA GGA TGA T-3',P55 RB safflower,and rice for the adventitious pres- thirds volume of isopropanol. The DNA REV 5'-TAG TAG GTT TCC ATA CCA AGG ence of transgenes through various PCR pellet was dissolved in 200 µL TE buffer, CTC-3', and P55 RBint FOR 5'-CCT CCG techniques for selectable makers,promoters, incubated with 1.tg•mL-'RNase at 37°C for AAA TAC CAA TAG ACA TGA-3'. or genes of interest(Christianson et al.,2008; 30 min, extracted with phenol:chloroform: Typically,54 of isolated DNA was used Demeke et al., 2006; Freese et al., 2007). isoamyl alcohol (25:24:1), and precipitated for each PCR reaction consisting of lx Taq Statistical methods(i.e.,SeedCalc)have been with 1/10 volume of 5 M ammonium acetate buffer,2.5 mM MgC12,0.2 trim dNTP,0.2µM developed to assist in designing and imple- and two volumes of ethanol. DNA was of each primer (with the exception of P55 menting seed testing procedures to detect the resuspended in 100 µL TE buffer and typi- LFR FOR and P55 RFR REV, which were adventitious presence of transgenes and ana- cally 51.1L was used in each PCR reaction. used at 0.411M),and 1 unit of Taq or Go Taq lyze risk considerations for seed producers DNA extraction from papaya seeds. Pa- polymerase (Promega Corp., Madison, WI). and seed consumers (Remund et al., 2001). paya seeds were counted,placed into a War- The PCR reactions consisted of incubation at We describe a procedure that has a higher ing blender(Waring Laboratory and Science, 95 °C for 5 min followed by 30 cycles of than normal producer risk resulting from the Torrington, CT), and ground with four 10-s 95°C for 30 s,54°C for 30 s,72°C for 1 min, potential of large numbers of seeds not meet- bursts with sample mixing between each 30 s with 5 s/cycle extension,and then a final ing the stringent criteria. We believe this is grinding interval. CTAB buffer preheated to extension at 72°C for 10 min.PCR samples necessary for our role in germplasm conser- 60°C was added to the papaya seed powder were run on a 1%agarose TAE gel. vation and distribution. However, others can and ground for an additional 5 s.The samples Polymerase chain reaction detection of still use the same protocols outlined in this were placed in a 250-mL centrifuge tube with 0-glucoronidase and PRSVcp in 55-1 article by lowering the stringency of the re- 100 mL CTAB buffer at a final dilution of 100 transgene insertion.The multiplex PCR pro- jection criteria.To the best of our knowledge, mL per 500 seeds.Samples were incubated at tocol to amplify the GUS(uidA)or PRSVcp this is the first publication on the detection of 60 °C for 30 min with intermittent shaking. within the transgene of 55-1 to indicate the the adventitious presence of transgenes in The slurry was filtered through Miracloth transgenic event and papain as an internal large-scale nonhomogeneous papaya seeds. (Calbiochem,San Diego,CA)and 45 mL of control was used in this study (Wall et al., the filtrate was centrifuged at 4500 rpm in 2004).The primer sequences are:Papain 1-5 Materials and Methods a Marathon 2100R (Fisher Scientific, Pitts- FOR 5'-GGG CAT TCT CAG CTG TTG burgh, PA) for 10 min at 4 °C. Thirty mil- TA-3',Papain 1-3 REV 5'-CGA CAA TAA Papaya cultivation. Transgenic papaya liliters of the resulting supernatant was CGT TGC ACT CC-3', p355-cf3 FOR 5'- seeds of SunUp'and`Rainbow' [kindly pro- extracted with 20 mL of 24:1 chloroform:oc- CCA CGT CTT CAA AGC AAG TGG-3', vided by the Hawaii Papaya Industry Associ- tanol and centrifuged at 4500 rpm for 10 min PRSVcp REV 5'-GCA TCC ACA GCT TCA anon (HPIA)] and nontransgenic `Kapoho', at 4°C.The aqueous layer was removed and TTC TTG-3',and GUS n 3'-TCG TTA AAA `Sunrise', `Sunset', `Waimanalo', and `Sun- precipitated with two-thirds volume of iso- CTG CCT GGC AC-3'. rise' x `Kapoho' hybrid seeds (provided by propanol. The resulting DNA pellet was Typically, 200 ng of purified DNA was TPGRMU and HPIA)were used in the study. washed with 70%ethanol and air-dried.The used for each PCR reaction consisting of lx Papaya seeds were soaked overnight in water, DNA was resuspended in 200 µL of TE Taq buffer,2.5 mM MgC12,0.2 mM dNTP,0.2 rinsed three times, soaked for 30 min in 2.5 buffer. A DNA cleanup procedure using the µM of each primer,and 1 unit of Taq or Go mM GA3(Dr.Rod.Drew,personal communi- Plant DNAeasy kit (Qiagen, Valencia, CA) Taq polymerase (Promega Corp.). The PCR cation), and planted in a 1:1 perlite:vermicu- was used to purify the papaya DNA in which reaction consisted of incubation at 95°C for lite media in a seedling tray on a heat mat(30 70 µL of the papaya DNA was mixed with 5 min followed by 30 cycles of 95°C for 30 s, °C).Misting intervals were set so temperatures 400 itL of AP 1 buffer.Subsequent steps were 59°C for 25 s,72°C for 15 s,and then a final did not exceed 30°C.Seeds generally germi- followed using the manufacturer's protocol. extension at 72 °C for 5 min (Wall et al., nated in 1 to 4 weeks. Seedlings were trans- Polymerase chain reaction determination 2004). PCR samples were run on a 2% planted at the four true leaf stage to cell packs of sex and presence of 55-1 transgene inser- agarose TAE gel. (256 cm')consisting of two parts of Sunshine tion. The random amplified polymorphic mix#4(Sun Gro Horticulture,Bellvue,WA) DNA markers SCAR T1 and SCAR W11 Results and Discussion supplemented with one part of perlite.Plants were used to distinguish female and her- were kept in a covered greenhouse and fertil- maphrodite papaya seedlings(Deputy et al., We describe a protocol to screen the ized bimonthly with 14.7 mL of 16N-7P— 2002).The primer sequences used to amplify regenerated plant material for the presence 13.3K plus micronutrients and monthly with SCAR Tl and W11 were T1 FOR 5'-TGC of the transgene derived from the original 14.7 mL•L-' of 30N-4.4P-8.4K foliar fertil- TCT TGA TAT GCT CTC TG-3',T1 REV PRSV coat protein transformed line 55-1.We izer. Plants were field planted 3 to 4 months 5'TAC CTT CGC TCA CCT CTG CA-3', screened the parental line for the presence of after initial transplant. W 11 FOR 5'-CTG ATG CGT GTG TGG the transgene using the left and right flanking DNA extraction from parental papaya CTC TA-3', and W 11 REV 5'-CTG ATG regions of the transgene.In addition,we also lines. Samples were collected using a No. 8 CGT GAT CAT CTA CT-3'. screened these lines for sex determination to cork borer.Seven leaf discs(u 100 mg)were PCR amplification of the transgenic event identify the hermaphrodites at an early stage placed into a 1.5-mL microcentrifuge tube used the sequence flanking the transgene of development. Identification of the her- with a hole in the cover to allow air to escape insertion into the genomic DNA of the maphrodites at the seedling stage saves on when freezing in liquid nitrogen. The cork papaya plant where the forward primer of manpower required to remove the undesired borer was washed in water and 70%ethanol the left flanking region(LFR)and the reverse female plants after flowering. Finally, we and wiped dry between samples. The plant primer of the right flanking region(RFR)are also describe a procedure to test the resulting tissue was frozen in liquid nitrogen and located in papaya genomic DNA outside of seeds for the presence of adventitious trans- homogenized using a pestle for 1.5-mL the transformed plasmid insertion and the gene insertions in seed material using the microcentrifuge tubes. DNA was extracted remaining primers are sequences within the genes in the PRSV coat protein gene. We using the method from Doyle and Doyle transgene(Suzuki and Tripathi,unpublished used two different gene products for testing (1990) with minor modifications. Briefly, results). The primer were developed by Dr. the parental and seed material to accommo- 100 mg of ground papaya leaf tissue was Jon Y. Suzuki and Dr. Savarni Tripathi; the date for any rearrangements that may occur mixed with a 750-4 CTAB solution (3% sequences are: P55 LFR FOR 5'-ATT TAC through sexual reproduction. 162 HORTSCIENCE VOL.45(1)JANUARY 2010 A LFR `Kapoho', `Rainbow', `Sunrise', `SunUp',and c `Waimanalo' for sex determination with an 8 ° ° 0 8 M SU SR KP RB M accuracy of u90%. Although this is lower ' 8 ' g, c M than the published accuracy of 99%(Deputy et al., 2002), we believe the error rate may not be the result of PCR detection, but in- stead inadvertent mixing of material at the time of transplanting from the cell pack to the field. We now have a revised protocol in which three to five seedlings are planted into the field and individual plants are flagged bp 576 bp—s• and tested by PCR. If the plant is found to 273 b —► y p 211 bp bp--* be female, the seedling is removed and the next seedling is then flagged and tested by B RFR PCR. This process is continued until the entire field contains one hermaphrodite plant Fig.2.PCR amplification of genomic DNA from M SU SR KP RB M per hole. nontransgenic seeds"spiked"with seeds from We have tested over 300 seedlings of `SunUp' at concentrations of 1:100, 1:250, nontransgenic papaya accessions `Kapoho', 1:500,1:1000,1:2000,and control(0:500 non- Sunrise', and `Waimanalo' with the LFR transgenic)seeds.The papain segment(211 bp) is amplified in all samples, whereas the primer pair and we have not found the PRSVcp (273 bp)segment is only present in presence of the transgene insertion.Seedlings the seed lots "spiked" with transgenic seeds. used in this study were generated from seeds Transgene detection can be observed at con- produced within the last 2 to 3 years during centrations as low as 1:2000. 566 bp—. a period in which `Rainbow' was the most common papaya cultivar grown in Hawaii. first is that these primers have been estab- 244 bp-. This is an encouraging indicator that the lished to work in papaya seeds (Wall et al., current methods to exclude extraneous pollen 2004) and second is that these primers am- SEX from our germplasm material are currently plify different segments than those used for working. We believe the absence of trans- analysis of the parental lines.These primers M SU SR KP RB M genic material from our germplasm material would still detect the transgene in case of is a result of the bagging of the flower before subsequent rearrangements of the genomic the stigma is receptive to pollen to prevent DNA. In addition,because the GUS gene is unexpected contamination. Although this a common transformation marker, these added PCR procedure may not be practical primers would be able to detect transgenic for testing all germplasm material, the rela- papaya seeds derived from other transforma- tively small number of Carica papaya acces- tion events that are mixed into the seed 1,300 bp—i sions,compared with other seed crops such as population.As more transgenic papaya lines 800 bp--► maize,makes it feasible to test our material. are released in the United States, we will An example of a gel of papaya seedlings modify these primers to ensure that the seeds tested for sex and the presence of the trans- will be tested for all of the different trans- gene is shown in Figure 1. genic events. Polymerase chain reaction detection of From these results, we have generated Fig. 1.Polymerase chain reaction amplification of R-glucoronidase and PRSVcp in papaya a working protocol for the regeneration of genomic DNA from `SunUp' (SU), `Sunrise' seeds. To test each batch of seeds, we de- Carica papaya seed.Papaya seeds are either (SR),`Kapoho'(KP),and`Rainbow'(RB).(A) termined that a zero tolerance testing plan of directly seeded in the field or three to five The higher molecular weight band (576 bp) SeedCalc Version 7.1 (Remund et al.,2001), seedlings are transplanted per planting space. amplified from a region internal to the trans- which uses 1500 seeds,will result in a 99.9% DNA is extracted from the leaves of the gene and in the left flanking region (LFR) genomic DNA and present only in transgenic confidence level that the tested seeds will be papaya plants and is subjected to two PCR lines(SU and RB),whereas the lower molec- 99.54% transgene-free. These calculations protocols,the first to determine the sex of the ular weight(176 bp) band is external to the are further supported by the calculated sta- plant using the SCAR W11 and SCAR T1 transgene and present in both transgenic(SU tistics in Couey and Chew (1986). To de- primer sets(Deputy et al.,2002)and second and RB) and nontransgenic (SR and KP) termine the limits of detection for our system, to determine the presence or absence of the papaya lines.(B)The higher molecular weight we used transgenic:nontransgenic seeds at 55-1 transgenic event using the 55-1 LFR band(566 bp)amplified from a region internal ratios of 0:500, 1:100; 1:250, 1:500; 1:1000, and/or RFR primer sets(Suzuki and Tripathi, to the transgene and in the right flanking region and 1:2000(Fig.2).Although the presence of unpublished results).Female plants and trans- (RFR) genomic DNA and present only in the transgenes could be detected in concen- genic plants would be discarded and the transgenic lines (SU and RB), whereas the lower molecular weight (244 bp) band is trations as low as 1:2000,we took a conser- screening process would continue until her- external to the transgene and present in both vative approach and used three random maphrodite and nontransgenic plant material transgenic(SU and RB)and nontransgenic(SR samples of 500 seeds to test a total 1500 is achieved. Descriptor data of the growth and KP)papaya lines.(C)SCAR Ti(1300 bp) seeds.In all of our routine testing procedures, characteristics of the plant,flower,and fruits and SCAR WI 1 (800 bp) were used to de- in parallel to our samples,we extracted DNA will be noted to ensure these data are consis- termine the sex of the papaya lines where the from previously tested nontransgenic seed tent within the accession. Once the papaya presence of both bands indicated the hermaph- batches to serve as negative controls and plant matures to flowering, the flowers are rodites(SU and SR),whereas the amplification DNA extracted from a 1:500 transgenic seed bagged before anthesis with glassine enve- of Ti band alone indicated female lines(KP annd d RB)(Deputy et al.,2002). to nontransgenic seeds to serve as a positive lopes and tagged with the genetic cross and PCR amplification control. date.As the fruit matures,the information on Polymerase chain reaction determination In our seed testing procedure, we tested the tag is written directly onto the fruit.The of sex and presence of 55-1 transgene in- for the presence of GUS (uidA) and PRSV fruits are harvested at color break and seeds sertion event in parental lines. We have coat protein segments(Wall et al.,2004).We of the same genetic cross are processed tested over 1000 papaya seedlings of used these primer sets for two reasons; the together. The seeds are cleaned to remove HORTSCIENCE VOL.45(1)JANUARY 2010 163 the sarcotesta using a food processor with overview for Canadian grains. Can. J. Plant Ohmori,K.,J.Tsuchiya,T.Watanabe,H.Akiyama, plastic blades and dried in a dehumidifier Sci.86:1-23. T. Maitani, T. Yamada, K. Hirayama, and S. cabinet to a moisture content of ra5%.Three Deputy, J.C., R. Ming, H. Ma, Z. Liu, M.M.M. Satoh.2008.A DNA extraction method using random samples of 500 seeds are taken for Fitch,M.Wang,R.Manshardt,and J.I.Stiles. silica-base resin type kit for the detection of seed testing using the uidA and PRSVcp 2002.Molecular markers for sex determination genetically modified papaya.J.Food Hyg.Soc. primer sets (Wall et al., 2004). Seeds will in papaya (Carica papaya L.). Theor. Appl. Jpn.49:63-69. be tested with negative and positive controls Genet. 106:107-111. Remund,K.M.,D.A.Dixon,D.L.Wright,and L.R. and if determined to contain the transgene, Doyle, J.J. and J.L. Doyle. 1990. Isolation of Holden.2001.Statistical considerations in seed plant DNA from fresh tissue. Focus 12:13— purity testing for transgenic traits. Seed Sci. a second sample will be tested. If the pres- 15. Res. 11:101-119. ence of the transgene is confirmed,the seed Fitch, M.M.M., R.M. Manshardt, D. Gonsalves, USDA, ARS, National Genetic Resources Pro- lot will be destroyed.In addition to testing for J.L. Slightom, and J.C. Sanford. 1992. Virus gram.Germplasm Resources Information Net- the adventitious presence of the 55-1 trans- resistant papaya plants derived from tissues work (GRIN) [online database]. National gene construct, 100 seeds are used to de- bombarded with the coat protein gene of Germplasm Resources Laboratory, Beltsville, termine the germination percentage and 100 g papaya ringspot virus. BioTechnology 10: MD. 16 Sept.2008.<http://www.ars-grin.gov/ of seed is placed into storage. We believe 1466-1472. cgi-bin/npgs/html/desclist.pl?126>. that our current management method, to- Freese, L., T.A. Scholdberg, D.D. Burton, T.D. USDA, National Agricultural Statistics Service gether with testing the parental lines for the Norden, L.A. Shokere, and G.R. Jenkins. and State of Hawaii Department of Agricutlure presence of the transgene,will further ensure 2007.Evaluating homogeneity of LL601 rice Agricultural Development Division. Hawaii the genetic integrity of our Carica papaya in commercial lots using quantitative real- papayas.27 Oct.2009.<http://www.nass.usda. germpl genetic accessions. time PCR. J. Agr. Food Chem. 55:6060— gov/Statistics_by_State/Hawaii/Publications/ 6066. Fruits_and_Nuts/papaya.pdf>. Gonsalves,D.,A.Vegas,V.Prasartsee,R.Drew, Van Droogenbroeck,B.,T.Kybdt,I.Maertens,E. Literature Cited J.Y.Suzuki,and S.Tripathi.2006.Developing Romeijn-Peeters,X.Scheldman,J.P.Romero- Christianson, J., M. McPherson, D. Topinka, L. papaya to control papaya ringspot virus by Motochi,P.Van Damme,P.Goetghebeur,and Hall, and A.G. Good. 2008. Detecting and transgenic resistance, intergeneric hybridiza- G.Gheysen.2004.Phylogenic analysis of the quantifying the adventitious presence of trans- tion,and tolerance breeding.Plant Breed.Rev. highland (Vasconcellea) and allied genera genic seeds in safflower,Carthamus tinctorius 26:35-78. (Caricaceae) using PCR-RFLP. Theor. Appl. L.J.Agr.Food Chem.56:5506-5513. Ling,K.,S.Namba,C.Gonsalves,J.L.Slightom, Genet. 108:1473-1486. Couey, H.M. and V. Chew. 1986. Confidence and D. Gonsalves. 1991. Protection against Wall,E.M.,T.S.Lawrence,M.J.Green,and M.E. limits and sample size in quarantine research. detrimental effects of potyvirus infection in Rott. 2004. Detection and identification of J.Econ.Ent.79:887-890. transgenic tobacco plants expressing the pa- transgenic virus resistant papaya and squash Demeke,T.,D.J.Perry,and W.R.Scowcrofi.2006. paya ringspot virus coat protein gene. Bio- by multiplex PCR. Eur. Food Res. Technol. Adventitious presence of GMOs: Scientific Technology 9:752-758. 219:90-96. 164 HORTSCIENCE VOL.45(1)JANUARY 2010 JOURNAL OF COUNTY CLERK AGRICULTURAL AND COUNTY OF HAWAII AMICLL FOOD CHEMISTRY 200 MAY 31 AM fl: $ 1 pubs.acs.org/JAFC Allergenicity Assessment of the Papaya Ringspot Virus Coat Protein Expressed in Transgenic Rainbow Papaya Gustavo Fermin,t'*'11 Ronald C. Keith,t Jon Y. Suzuki,* Stephen A. Ferreira,# Douglas A. Gaskill,* Karen Y. Fitz,* Richard M. Manshardt, Dennis Gonsalves,* and Savarni Tripathi*'t'* tUSDA-ARS-Pacific Basin Agricultural Research Center,Hilo,Hawaii 96720,United States *Department of Plant and Environmental Protection Sciences and§Department of Tropical Plant and Soil Sciences,College of Tropical Agriculture and Human Resources,University of Hawaii at Mama,Honolulu,Hawaii 96822,United States ABSTRACT: The virus-resistant,transgenic commercial papaya Rainbow and SunUp (Carica papaya L.) have been consumed locally in Hawaii and elsewhere in the mainland United States and Canada since their release to planters in Hawaii in 1998.These papaya are derived from transgenic papaya line 55-1 and carry the coat protein(CP)gene of papaya ringspot virus (PRSV).The PRSV CP was evaluated for potential allergenicity,an important component in assessing the safety of food derived from transgenic plants.The transgene PRSV CP sequence of Rainbow papaya did not exhibit greater than 35%amino acid sequence homology to known allergens,nor did it have a stretch of eight amino acids found in known allergens which are known common bioinformatic methods used for assessing similarity to allergen proteins. PRSV CP was also tested for stability in simulated gastric fluid and simulated intestinal fluid and under various heat treatments.The results showed that PRSV CP was degraded under conditions for which allergenic proteins relative to nonallergens are purported to be stable.The potential human intake of transgene-derived PRSV CP was assessed by measuring CP levels in Rainbow and SunUp along with estimating the fruit consumption rates and was compared to potential intake estimates of PRSV CP from naturally infected nontransgenic papaya.Following accepted allergenicity assessment criteria,our results show that the transgene-derived PRSV CP does not pose a risk of food allergy. KEYWORDS:papaya ringspot virus,transgenic papaya,Rainbow,allergenicity,coat protein • INTRODUCTION their potential allergenicity,including comparison of transgene Genetically engineered (GE) papaya, Rainbow and SunUp, proteins to known allergens at the amino acid sequence level and were developed on the basis of the concept of pathogen-derived digestibility analysis of the engineered proteins in controlled resistance'using the papaya ringspot virus(PRSV)coat protein experiments using simulated gastric and intestinal fluids, were (CP) gene to protect the host plants against PRSV infection. performed. Although acidic conditions and proteolytic en- PRSV is an aphid-transmitted, single-stranded RNA virus that zymes present in the mammalian gastrointestinal (GI) tract belongs with the family Potyviridae, and it is the most serious efficiently denature and degrade most ingested proteins into problem for papaya cultivation worldwide.2 In Hawaii, PRSV constituent amino acids and small peptides, causing loss of the protein structure and biological activity and serving as a nutrient severely damaged the papaya industry and reduced papaya source,Is according to a January 2001 report by the joint FAO/ production by 50%, from 24 million kg in 1992 to 12 million WHO expert consultation on allergenicity of foods derived from kg in 1998.3 In 1998,PRSV-resistant transgenic papaya,Rainbow biotechnology, there is a supposed correlation, albeit weak, and SunUp, were deregulated for commercial cultivation in between the indigestibility of a protein by enzymes present in Hawaii,which subsequently saved the Hawaiian papaya industry. the alimentary tract and potential allergenicity. Today,Rainbow alone accounts for more than 70%of the total In addition to analysis of its potential allergenicity,PRSV CP papaya acreage in the state:"The PRSV-resistant papaya Rain- was also evaluated for heat stability as a test for persistence during bow is an F1 hybrid of SunUp crossed with a nontransgenic processing,and its potential exposure to humans was estimated. cultivar, Kapoho,whereas SunUp is a cultivar homozygous for In this study,we present evidence that consumption of Rainbow the PRSV CP transgene and is derived from transgenic line 55-1, and SunUp papaya transformed with the PRSV CP gene poses no a line which was created by transforming the nontransgenic increased risk of potential allergenicity. inbred cultivar,Sunset.5 Our previous report has shown that the nutritional composition of Rainbow papaya is similar to that of MATERIALS AND METHODS •nontransgenic papaya, a finding that addressed the biosafety issue that there should be"substantial equivalence"or in other Bioinformatic Analysis of the PRSV CP Sequence.The PRSV words no significant differences between GE and non-GE CP transgene sequence(GenBank accession no.FJ467933)was used as counterparts. Generally,food allergy is one of the main biosafety concerns Received: March 24,2011 for any food derived from GE organisms. To assess the aller- Accepted: August 7,2011 genicity of the transgene PRSV CP, multiple criteria were Revised: July 31,2011 evaluated in this study.The most widely used criteria to assess ACS Publications ©XXXX American Chemical Society A dx.doi.org/10.1021/jf201194r I J.Agric.Food Chem.XXXX,XXX,000-000 Journal of Agricultural and Food Chemistry ar;T J a query in the following databases: (1) the Structural Database of 30 min and resuspended in 50 mL of cold lysis buffer [20 mM 4-(2- Allergenic Proteins(SDAP)of the University of Texas Medical Branch hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 500 mM (http://fermi.utmb.edu/SDAP/);16 (2) the Allergen Database for NaCI, 1 mM ethylenediaminetetraacetic acid (EDTA), 0.1% Triton Food Safety(ADFS;http://al lergen.nihs.go.jp/ADFS/index.jsp);(3) X-100,and 20 uM phenylmethanesulfonyl fluoride(PMSF),pH 8.0]. the AllergenOnline version 11 database (http://www.allergenonline. Bacteria were sonicated and centrifuged at 20000g and 4°C for 30 min, corn/). SDAP was developed using the allergens list from the IUIS and the clarified supernatant was loaded onto a chitin bead column (International Union of Immunological Societies) Web site, http:// equilibrated with column buffer(20 mM HEPES,500 mM NaCI,1 mM www.allergen.org, supplemented with information from the literature EDTA,pH 8.0).The column was washed with 12 bed volumes of 1 M and from major sequence (SwissProt,PIR,and NCBI) and structural NaCl,and cleavage was induced by incubating the column in cleavage (PDB) databases and contains 1425 allergen sequences. The ADFS buffer[20 mM HEPES,500 mM NaC1,1 mM EDTA,pH 8.0,50 mM Web site and AllergenOnline contain 1285 and 1491 peer-reviewed dithiothreitol (DTT)] for 40 h. The PRSV CP was eluted from the sequences,respectively.Our query sequence was subjected in all three column with 20 mM HEPES,500 mM NaCI,1 mM EDTA,pH 8.0.The databases to full FASTA searches (using<0.01 E score cutoff), >35% protein concentration of 1 mL eluate fractions was measured using the identity over an 80 amino acid window, and searches for eight Bradford reagent according to the manufacturer's instructions(BioRad, contiguous identical amino acid matches to known allergenic proteins Hercules,CA).Fraction samples were also run in SDS—PAGE,and the as recommended by Codex.8 CP identity was confirmed by Western blot analysis using antibodies Purification of Native PRSV Particles. Greenhouse-grown raised against PRSV particles.Samples were dialyzed with at least 2000 nontransgenic Sunrise papaya was inoculated with a 1:10 dilution of volumes of 20 mM HEPES, pH 6.5. All purification steps were PRSV-infected papaya plant tissue in inoculation buffer (phosphate performed at 4°C. buffer,0.01 M,pH 7.5,0.1%sodium sulfate, 10 mM EDTA).Twenty- SDS—PAGE and Western Blot Analysis.Samples were boiled one days after inoculation, samples were taken from infected Sunrise for 5 min,cooled on ice,and electrophoresed in 10%or 12%denaturing papaya leaves and used in double antibody sandwich(DAS)-enzyme- SDS—polyacrylamide gels using Tris—glycine—SDS running buffer linked immunosorbent assay (ELISA) experiments to test for the prepared following standard methods20 on a Mini Protean II gel system presence of PRSV CP. Infected leaves (10 g) were collected from (Bio-Rad). Samples were visualized by Coomassie Brilliant Blue samples that tested positive for PRSV CP and were used for purification staining21 and/or transferred to poly(vinylidene fluoride) (PVDF) or of virus particles essentially by the method of Gonsalves and Ishii.17 nitrocellulose membranes by submarine or semidry electroblotting Infected papaya tissue was macerated in a blender with 10 mL of 0.01 M according to the manufacturer's instructions (Bio-Rad). Membranes phosphate buffer, pH 7.5, followed by addition of 5 mL of carbon were equilibrated with 1 x TBS (Tris-buffered saline: 20 mM Tris, tetrachloride and 5 mL of chloroform. The resulting mixture was 500 mM NaCI,pH 7.S)for 5 min and blocked with 1 x TBS,5%dry centrifuged for 10 min at 3697g.The supernatant was passed through nonfat milk,or 5%casein for at least 1 h.Following three washes in 1 x glass wool,stirred for 1 hat 4°C following the addition of PEG-8000 to TBS containing 0.05%Tween-20(1 x TTBS),the blocked membrane 10% (w/v),and centrifuged at 1643g.The resulting pellet was resus- was incubated for at least 2 h with primary antibody [serum raised pended in 2 mL of sterile distilled water, and NaC1 was added to a against PRSV HA 5-1 (Gonsalves laboratory, Cornell University, concentration of 0.3 M,followed by one extraction with chloroform to Geneva, NY) or against the chitin binding domain (anti-CBD, New eliminate the PEG. The aqueous phase was recovered and the virus England Biolabs)].After three washes in 1 x TTBS,membranes were protein concentration estimated using the Bradford method.18 incubated in secondary antibody from the Amplified Alkaline Phospha- Engineering of PRSV CP for Bacterial Expression.The CP tase Goat Anti-Rabbit Immun-Blot Assay Kit(Bio-Rad),washed three gene harbored by transgenic papaya line 55-1 is a chimeric gene more times in 1 x TTBS,and incubated with the alkaline phosphatase- comprised of nucleotides corresponding to the first 16 amino acids of streptavidin complex for at least 1 h.After a final washing step,the blot the cucumber mosaic virus CP gene and the coding region of the PRSV was developed by either colorimetric (Bio-Rad) or chemiluminescent CP gene.19 The coding region of the chimeric transgene was PCR (Roche Applied Science, Indianapolis,IN) methods according to the amplified(from a clone of Rainbow papaya genomic DNA),cloned as a manufacturers'instructions. translational fusion with the intein sequence present in vector pTYB1 or In Vitro Digestion of Coat Protein by Simulated Gastric pTYB11 (New England Biolabs, Inc., Ipswich, MA), and verified by Fluids. CP digestibility tests in simulated gastric fluid (SGF) were sequencing following standard molecular biology methods.2°Amplifica- performed using two different conditions.7'22 The first condition con- tion of the chimeric gene was performed with the following primer pairs: sisted of 50 pg of purified PRSV CP sample as the substrate plus the Hilo06-02, GGTGGTCATATGGACAAATCTGAAT (with the ATG addition of 2 or 10 pg of the protease,pepsin(pepsin:PRSV CP(w/w) codon of the CP gene in bold and the Ndel restriction site underlined), protein ratios of 1:25 and 1:5,respectively)in a total volume of 100µL, and Hllo07-02, GGTGGTTGCTCTTCCGCAGTTGCGCATAC 0.01 N HCI,pH 2.0.Samples were then incubated for 2 hat 37°C.As a (with the Sapl restriction site underlined)to engineer the CP gene into control, the protease inhibitor, pepstatin,23 was added to a final plasmid pTYB1 (for intein fusion at the C-terminus of the translated concentration of 5,uM 10 min prior to addition of the substrate.For CP);Hilo08-02,GGTGGTTGCTCTTCCAACATGGACAAATCTG the second condition,2 Ftg of purified PRSV CP was mixed with pepsin (with the ATG codon of the CP gene in bold and the SapI restriction site to obtain a final w/w pepsin:PRSV CP ratio of 13:1 or 6.5:1.SGF was underlined) and Hilo09-02, GGTGGTCCCGGGTTAGTTGCGCA- prepared as a pepsin solution(3.2 mg/mL)in 30 mM NaC1,pH 1.2.For TAC(with the SmaI restriction site underlined)to engineer the CP gene both experiments,samples were quenched after time course treatments into plasmid pTYB11 (for intein fusion at the N-terminus of the with equal volumes of 2x Laemmli's buffer,24 immediately boiled at translated CP). 100°C for 5 min,and cooled to room temperature,and an aliquot was Purification of the PRSV CP Expressed in Escherichia coli.A analyzed by SDS—PAGE.Pepsin(P7000)was purchased from Sigma- high expressing done of CP,intein-tagged at the C-terminus in E.coli Aldrich Inc.,St.Louis,MO. strain ER2566,was used for purification of PRSV CP.Isopropyl/3-o-1- In Vitro Digestion of Coat Protein by Simulated Intestinal thiogalactopyranoside(IPTG;final concentration 0.5 mM)was added Fluids. CP digestibility tests in simulated intestinal fluid (SIF) were to a 1 L culture in Luria broth (LB) supplemented with ampicillin performed using two different conditions.For the first condition, CP (50%tg/mL)at the late log phase,followed by further incubation at 16°C was incubated with varying amounts of bovine trypsin or pancreatin for 24 h.Bacteria were pelleted by centrifugation at 5000g and 4°C for (5,10,or 50 pg)in 0.01 M Tris buffer,pH 8.As a control,the protease B dx.doi.org/10.1021/jf201194r p.Agric.Food Chem.XXXX,XXX,000-000 Journal of Agricultural and Food Chemistry ARTICLE 1 2 3 4 5 1 2 3 4 5 A NOA t ��� 0.,t. DIGESTION TIME(SEC) n 0 1 2 3 4 5 N e+ .. . -. u!! i 3 .ate —CP _ 1 1 B DIGESTION TIME(SEC) Figure 1. SDS—PAGE (left panel) and Western blot analysis (right 0 1 2 3 4 5 panel)of CP-v in SGF containing pepsin A.Samples:lane 1,prestained MIM11Ml1111111111 ., 1-CP protein markers;lane 2,CP-v only;lane 3,CP-v incubated with buffer (pH 2);lane 4,CP-v incubated with pepsin A(10µg)for 2 h;lane 5, CP-v incubated with pepsin A(10µg)and pepstatin for 2 h.The mole- C DIGESTION TIME(SEC) cular masses(kDa)of the protein markers are shown at the left. 0 1 2 3 4 —CP inhibitor, leupeptin,2S was added to one of the samples at a final concentration of 10µM 10 min prior to addition of the substrate. Following incubation at 37°C for 1 or 2 h,each reaction was stopped by —PEPSIN addition of an equal volume of Laemmli's sample buffer and boiled at 100°C for 5 min.For the second condition,single-tube digestions were —CP performed in SIF consisting of 10 mg/mL pancreatin in 0.05 M KH2PO4i pH 7.5.Reactions were stopped as described above.Bovine trypsin (TPCK-inhibited), pancreatin, pepstatin, and leupeptin were Figure 2. SGF digestion of partially purified native and purified purchased from Sigma-Aldrich. recombinant PRSV CP(CP-v and CP-b,respectively)containing pepsin Heat Stability Assay.A heat stability assay was performed using A. (A)Western blot analysis of 2µg of CP-v digested with 13µg of native PRSV CP in host plant matrix which consisted of PRSV-infected pepsin (w/w ratio of 6.5:1,pepsin:CP) for 0-5 s. (B) Western blot Sunrise leaves.Leaf samples(100 mg)were ground in 600µL of protein analysis of 2µg of CP-v digested with 26µg of pepsin(w/w ratio of 13:1, extraction buffer(50 mM Tris—HCI,pH 6.8,4%SDS,2%/3-mercap- pepsin:CP)for 0-5 s.(C)SDS—PAGE analysis of 2µg of purified CP-b toethanol, 10%glycerol,0.001%bromophenol blue) and immediately digested with 26µg of pepsin(w/w ratio of 13:1,pepsin:CP)for 0-4 s. heated at 100 °C for 2 or 4 h. PRSV-infected Sunrise papaya leaves Labels indicate the positions of CP and pepsin bands. (100 mg)were baked for the 206°C heat treatment,reconstituted to 100 mg,and extracted in 600µL of protein extraction buffer.Extracts for SGF Assay of PRSV CP.The digestibility of PRSV CP,tested the different temperature treatments (15µL each)were subjected to by both simulated gastric fluid and simulated intestinal fluid,was SDS—PAGE and Western blot analysis. performed on CP from isolated native virus or from bacterially Estimation of PRSV Coat Protein Levels in Transgenic expressed transgene sequence-derived CP.The protein purified Papaya. Fully ripened (100% yellow skin color) papaya fruit of from bacteria is referred to as CP-b,whereas CP partially purified Rainbow, SunUp, and noninfected Sunset as well as PRSV-infected from native PRSV particles is referred as CP-v. Kamiya cultivars was used for determining CP levels in the fruit.Leaf samples of Rainbow,SunUp,and noninfected Kapoho as well as PRSV- Initial SGF experiments using a ratio of 1:25 or 1:5 of the infected Kapoho were used for determining CP levels in the leaves.Coat protease, pepsin, to PRSV CP target protein resulted in the protein levels were quantified using ELISA using a monoclonal antibody disappearance of PRSV CP when the reaction was incubated for to PRSV CP.A standard volume of a dilution series(1.0x,0.2x,0.1x, 2 h (Figure 1). Minimal or no change in the CP-v level was 0.04x,0.02x,and 0.01 x)of purified PRSV CP particles ranging from observed in samples incubated for 2 h in medium similar to 0.025 to 25µg of CP was used to generate a standard curve for each gastrointestinal fluids with respect to pH (pH 2.0),but lacking ELISA assay,allowing the quantitation of CP in papaya samples from pepsin A. Similarly, a minimal change in the CP-v level was absorbance(A405)values. observed in samples containing the protease inhibitor pepstatin in addition to pepsin A, supporting the notion that pepsin A • RESULTS facilitated enzymatic degradation of PRSV CP in SGF. In addition to protein bands of molecular mass corresponding to Sequence Analysis of PRSV CP for Predicting Potential that of a PRSV CP monomer, ^'36 kDa, we observed higher Allergenicity.Potential CP allergenicity was assessed by search- order aggregates often observed in low ionic strength medium,as ing for PRSV CP transgene amino acid sequence similarity to well as a ^-25 kDa degradation product of PRSV CP that is known allergens in the databases as described in the Materials and commonly observed in PRSV CP pzurified from virus particles Methods. The similarity search for transgene PRSV CP amino and other potyvirus preparations.17 6 acid sequences was performed by one or more of three standard In subsequent experiments we tested ratios of protease to methods: (1)full FASTA search for homologous proteins in the target protein that have become the current standard and databases,(2)search for database proteins with>35%similarity observed a more rapid time course for PRSV CP degradation. to PRSV CP over an 80 amino acid window.No known allergen At a protease target protein ratio of 6.5:1 (pepsin:CP), a was found to be similar to PRSV CP by full FASTA search or by substantial amount of the CP-v was degraded within 5 s the criterion requiring>35%overall similarity over an 80 amino (Figure 2A),whereas nearly complete degradation was observed acid window.In addition,we also searched for short(eight amino at 5 s using a ratio of 13:1 (Figure 2B).Similarly,degradation of acid) contiguous stretches of identical amino acids between CP-b was nearly complete after 5 s,when a 13:1 ratio (pepsin: proteins in the allergen database and PRSV CP.There were no CP-b) was used (Figure 2C). Similar to CP purified from the eight contiguous amino acid matches between PRSV CP and virus, higher order aggregates of bacterially expressed and known allergens in the searched databases. purified PRSV CP were observed. C dx.doi.org/10.1021/jf201194r1/.Agric.Food Chem.XXXX,XXX,000-000 Journal of Agricultural and Food Chemistry ARTICLE KDA 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 6 7 ow" KDA 111 s r 80 wo. *44 ! 100 61 wore 49 ,�'t . . 45 36 our • t .+I�ir 3° 28 13 20 gm *** 10 Figure 3. SD —PAGE (left panel) and Western blot (right panel) analysis of CP-v in SIF containing trypsin.Samples:lane 1,prestained protein markers;lane 2,CP-v alone;lane 3,CP-v incubated with buffer Figure 5. Western blot analysis of heat-treated PRSV-infected papaya (pH 8)only;lane 4,CP-v incubated with trypsin(50µg)for 2 h;lane 5, leaf samples using a polyclonal antibody to PRSV CP.Samples:lane 1, CP-v incubated with trypsin(50µg)and leupeptin.Trypsin(^-24 kDa) protein molecular mass marker;lane 2,noninfected papaya leaves with comigrates with a —22 kDa fragment of PRSV CP. The molecular no treatment;lane 3,PRSV-infected sample with no treatment;lane 4, masses(kDa)of the protein markers are shown at the left. PRSV-infected papaya sample heated at 100 °C for 120 min; lane 5, PRSV-infected sample treated at 100°C for 240 min; lane 6, PRSV- infected sample treated at 206 °C for 20 min; lane 7, noninfected DIGESTION TIME(MIN) Rainbow papaya sample used as a transgenic control. The molecular 0 5 10 15 20 masses(kDa)of protein markers are shown at the left. —C° Table 1. PRSV Coat Protein Levels in Transgenic and Non- _" transgenic Papaya Fruit and Leaf Tissues" papaya no.of coat protein level type of tissue cultivar samples (ug/g of fresh mass)±SD Figure 4. Western blot analysis of PRSV CP digestion in SIF containing fruit Rainbow 5 6.3+2.1 pancreatin.The labels indicate the positions of the CP bands. SunUp 5 ND" Sunset 5 ND' SIF Assay of PRSV CP.Initial SIF experiments with CP-v and Kamiya(infected) 5 48.5±28.3 trypsin,the serine protease found in the upper small intestine, with or without the serine and cysteine protease inhibitor leaf Rainbow 1 257.6 leupeptin, indicated that trypsin could effectively degrade the SunUp 1 137.0 CP in buffer at pH 8.0 within 2 h (Figure 3),whereas a minor Kapoho(infected) 1 3580.6 proteolytic product of ^-20 kDa still remained when lower Kapoho 1 ND amounts of trypsin were used(data not shown). a Rainbow and SunUp are 55-1 line-derived transgenic papaya,while Time course experiments using pancreatin,an enzyme mixture Kapoho, Kamiya, and Sunset are nontransgenic papaya cultivars. CP simulating pancreatic secretions of the GI tract and comprised levels for the different cultivars and tissue types were quantified not only of trypsin but also of lipase and amylase,showed that using ELISA ND = nondetectable, below the limit of detection of degradation was evident by 5 min and a significant amount of CP 0.25µg of protein/g of fresh mass. was digested by 10 min(Figure 4). Heat Stability of Native PRSV Coat Protein in Plant Host However,the potential amount of PRSV CP entering the human Matrix. In experiments to test the effect of heat intensity and digestive tract from a transgene-derived source has not pre- duration on PRSV CP stability,we observed a significant loss of viously been thoroughly addressed. In an attempt to obtain an signal in Western blots utilizing a PRSV CP specific antibody estimate of the levels of CP being consumed, the amount of when crude leaf extracts of PRSV from infected papaya were PRSV CP in transgenic papaya fruit was measured by quantitative treated at 100°C for 2 h.Residual amounts of CP were observed ELISA on a per gram of fresh mass basis,and total consumption in the sample treated at 100°C for 4 h,whereas no bands were levels were calculated taking into account average fruit mass as detected when the sample was treated at 206°C for as short as well as potential fruit consumption rates.The amount of virus- 20 min. The multiple bands observed using the PRSV CP derived CP in PRSV-infected nontransgenic papaya fruit was also antibody,the highest of which correlated in size to the full-length calculated to estimate for comparison the potential human PRSV CP(^36 kDa),are attributed to degradation products in exposure to CP,given a scenario where no GE, PRSV-resistant the context of crude plant extracts as they were only detected plants were available.The data indicate that the CP level in the in extracts from infected leaves, but not in extracts from the fruit of Rainbow papaya,which is hemizygous for the transgene, noninfected control. The higher molecular mass band cone- was 7.7-fold lower than that of naturally infected nontransgenic sponding to the full-length CP seemed to degrade faster than papaya fruits (Table 1). CP levels in Sunup papaya, which is the proteins running as smaller molecular mass bands.This phe- homozygous for the transgene,were below the level of detection nomenon was also observed using other treatments(Figure 5). by ELISA It should be noted that, even for the Rainbow fruit Human Consumption of PRSV CP.In vitro tests in this study sample, transgene-derived CP could not be detected unless a suggest that PRSV CP is rapidly degraded by fluids simulating protease inhibitor(PMSF)was used in the assay,suggesting that those found in the human gastrointestinal (digestive) tract. the calculated transgene-derived CP amount likely overestimates D dx.doi.org/10.1021/jf201194r j/.Agric.Food Chem.XXXX,XXX,000-000 4111.. • 0 Journal of Agricultural and Food Chemistry ARTICLE Table 2. Consumption Level Estimates (mg/year) of PRSV and NPTII in Rainbow and SunUp papaya was estimated to be Coat Protein from Transgenic and Naturally PRSV-Infected lower than that of the CP in Rainbow (unpublished data; data Nontransgenic Papaya" submitted to the Japan Ministry of Health, Labor and Welfare a d and the Ministry of Agriculture,Forestry and Fisheries). fruit consumption rate Rainbow SunUp' virus-infected fruit The predictions of allergenicity of novel proteins are based on one fruit per day 1306.1 51.8 10055.0 bioinformatics and/or experimental approaches.8'9 The bioinfor- one fruit per week 186.1 7.4 1432.5 matics analysis showed that the PRSV CP did not show one fruit per month 42.9 1.7 330.6 significant similarity to any known allergenic proteins using the b criterion of significant overall homology, greater than 35% Based on an estimated average fruit mass of 568 g. Rainbow was measured to contain 6.3 ftg of CP/g of fresh mass of fruit,or 3.6 mg of similarity over a window of 80 amino acids and a contiguous CP/fruit. SunUp CP was not detected in the fruit.Assuming a CP level eight amino acid identical match,30 to any known allergen in the at the detection limit for CP,the level would equal 0.25,ug/g of fresh allergen database by full FASTA search. mass of fruit,or 0.14 mg of CP/fruit.d Nontransgenic infected fruit was Previously,Kleter and Peijnenburg31 identified a peptide of six measured to contain 48.5 Ftg of CP/g of fruit,or 27.5 mg of CP/fruit. amino acids (EKQKEK) shared by PRSV CP and an alleged allergen, ABA-1, a protein of the human parasite Ascaris true consumption levels, since some level of CP degradation lumbricoides or the pig parasite Ascaris suum. However, would be expected under normal food preparation conditions.By numerous reports show that a high percentage of proteins comparison to the levels measured in fruit,transgene-derived CP identified by six amino acid matches are false positives.32-37 generally accumulates to higher levels in the leaves, at least in Furthermore,we previously reported38 that the PRSV CP six transgenic papaya line 55-1,which thus allowed for the detection amino acid match to ABA-1 is not relevant with regard to of the CP in the leaves of SunUp. Similar to the relative allergenicity for several reasons: (1) the six amino acid differences in CP levels observed between the fruit,the amount sequence is not repeated in the coat protein sequence, and of CP accumulating in the leaves of SunUp was measured to be therefore,it will not trigger the IgE response associated with 1.9 times lower than that found in the leaves of Rainbow.The allergens,(2)the ABA-1 proposed allergenic peptide was not amount of CP accumulating in the leaves of Rainbow,in turn,was found to be inherently allergenic outside the context of other 13.9-fold lower than that of the leaves of PRSV-infected non- Ascaris proteins,39 and (3) although ABA-1 was listed in the transgenic papaya plants (Table 1). ADFS site,it is not among the officially recognized allergens On the basis of CP amounts measured in fruit,we calculated found in the International Union of Immunological Societies the potential annual cumulative CP consumption levels for (IUIS)allergen database (http://www.allergen.org). Rainbow and naturally infected nontransgenic papaya fruit on Another important aspect of assessing potential allergenicity is the basis of different fruit consumption rates in the diet; in the experimental testing for properties common to allergenic pro- case of SunUp,where CP was undetectable in fruit,an upper limit teins such as stability in simulated gastrointestinal fluids,which for CP consumption was estimated by using a theoretical number include SGF and SIF. SGF was developed to represent the equal to the minimum CP amount detectable by our ELISA assay conditions in the human stomach22 and basically consists of (0.25 Ftg/g of fresh mass).Using a theoretical maximum rate of the main gastric protease pepsin in low-pH medium.Some data one fruit per day,the cumulative annual CP consumption levels suggest that proteins that are susceptible to gastrointestinal were estimated to be approximately 1306 and 52 mg for Rainbow digestion are inherently safer than those that are stable,especially and SunUp,respectively(Table 2). For naturally infected non- in terms of allergenicity.7 transgenic papaya,the annual CP consumption level is estimated Our data show that the transgene sequence-derived PRSV CP to be at least 8-fold higher than that of Rainbow,the dominant is rapidly degraded in SGF. Many known allergens such as and most widely consumed cultivar in Hawaii. In other words, ovalbumin and phosvitin from egg,/3-lactoglobulin from milk, the estimated annual human exposure level of transgene-derived /3-conglycinin, lectin from soybean, sin al and bra j IE from CP from 365 Rainbow or SunUp fruits (based on a presumed mustard, and Ara h2 from peanut were stable up to 60 min in consumption rate of one fruit a day)would be roughly equivalent gastric fluid.The PRSV CP was completely and rapidly digested to the amount of virus-derived CP obtained by consuming 47 or in SGF within 5 s.Moreover,our results showed that the CP was 2 naturally PRSV-infected papaya,respectively. also not stable in SIF and completely degraded within 10 min. The PRSV CP harbors from 34 to 50 pepsin and 46 trypsin cleavage sites according to the ExPASy peptide cutter bioinfor- • DISCUSSION matics tool;40 therefore,it is not surprising that the coat protein is The PRSV CP is the major transgene protein expressed in degraded rapidly in gastrointestinal fluids. Rainbow and SunUp papaya along with the plant transformation There is no general rule concerning the effect of heat on food marker gene proteins NPTII and GUS.Our results of PRSV CP allergens,and it is not considered a good predictor of allergeni- digestibility in gastrointestinal fluids as well as bioinformatic city.Our heat treatment study of native PRSV CP in plant matrix analysis have shown that the transgene CP expressed in Rainbow indicated that the CP is unstable to heat treatments and it was and SunUp does not pose a risk of food allergy.Furthermore,the completely degraded at 206 °C.At higher temperature loss of amount of CP expressed in transgenic papaya was found to be tertiary structure as well as various changes in intra- and inter- 87-99% lower than the amount of CP found in naturally molecular interactions, including the formation of aggregates, infected nontransgenic papaya fruits. Hence, the CP exposure can occur.Heat can destroy the conformation and lead to loss of from human consumption of transgenic papaya is much lower immunobinding sites that trigger the allergenic response as in the than that from consuming naturally infected nontransgenic case of heat-labile allergens such as"Cor a"found in hazelnut 41 papaya. Previous studies documented the biosafety aspect of In other cases, allergenicity can occur as of result of the NPTII and GUS 27-29 Exposure to the transgene markers GUS linearization of epitopes during heating.42 In the case of PRSV E dx.doi.org/10.1021/jf201194r I.Agric.Food Chem.XXXX,XXX,000-000 Journal of Agricultural and Food Chemistry ARTICI CP,the CP pattern was altered after boiling or baking treatments (8) Codex. Codex Principles and Guidelines on Foods Derived from perhaps due to the molecular interactions described above. Biotechnology;Food and Agriculture Organization of the United Nations: In Hawaii, the papaya industry was saved from the damage Rome,Italy,2003. caused by the virus disease with the introduction of PRSV- (9) FAO/WHO.Allergenicity of Genetically Modified Foods;Food and resistant papaya Rainbow and SunUp,but the industry in Hawaii Agriculture Organization of the United Nations:Rome,Italy,2001. still faces the challenge of marketing GE papaya internationally. (10) Fu,T.J.;Abbott,U.R.;Hatzos,C.Digestibility of food allergens Japan and Canada have been and continue to be important and nonallergenic proteins in simulated gastric fluid and simulated intestinal fluid—A comparative study.J.Agric. Food Chem. 2002, SO export markets for Hawaii's papaya.In 2003, Canada approved (24),7154-7160. the importation of SunUp and Rainbow transgenic papaya (11) Harrison, L. A.; Bailey, M. R.; Naylor, M. W.; Ream, (http://www.hc-sc.gc.ca/fn-an/gmf-agm/appro/papaya-eng.php). J. E.; Hammond, B. G.; Nida, D.L.; Bumette, B. L.; Nickson,T. E.; On the other hand,application for the import and sale of line 55- Mitsky,T.A.;Taylor,M.L.;Fuchs,R.L.;Padgette,S.R The expressed 1-derived transgenic papaya in Japan is in the final stages of protein in glyphosate-tolerant soybean, 5-enolpyruviylshikimate-3- approval by the Ministry of Health, Labor and Welfare, the phosphate synthase from Agrobacterium sp strain CP4, is rapidly Food Safety Commission,the Ministry of Agriculture,Forestry digested in vitro and is not toxic to acutely gavaged mice.J.Nutr. 1996, and Fisheries, and the Ministry of the Environment (http:// 126,738-740. www.fsc.go.jp/sonota/kikansi/21gou/21gou_1_8.pdf; http:// (12) Herman, R. A; Storer, N. P.; Gao, Y. Digestion assays in allergenicity assessment of transgenic proteins.Environ.Health Perspect. www.f sc.go.jp/hyouka/hy/hy-tuuchi-papaya_55-1.pdf). One of 2006,114(8), 1154-1157. the main food safety concerns of Japanese regulators was (13) Roesler, K. R; Rao,A. G. Rapid gastric fluid digestion and whether the PRSV CP gene in GE papaya had introduced any biochemical characterization of engineered proteins enriched in essen- food allergenicity. tial aminoacids.J.Agric.Food Chem.2001,49,3443-3451. Finally, important evidence for supporting the safety of any (14) Taylor,S.L.Protein allergenicity assessment of foods produced food is a history of safe consumption. In Hawaii, transgenic through agricultural biotechnology.Annu.Rev.Pharmacol.Toxicol.2002, papaya fruits have been consumed for more than a decade since 42,99-112. their release in 1998 without any recorded adverse effect on (15) Metcalfe,D.D.;Astwood,J.D.;Townsend,R;Sampson,H.A.; human health.Furthermore,our detailed analysis of the Rainbow Taylor,S.L.;Fuchs,R L.Assessment of the allergenic potential of foods papaya and its nontransgenic counterpart show similar nutri- derived from genetically engineered crop plants.Crit.Rev.Food Sci.Nutr. tional and mineral elements, including papain, carpain, and 19(16) 165-186. 6 (16)) Ivanciuc, O.; Schein, C. H.; Braun,W. SDAP: Database and benzyl isothiocyanate(BITC). Thus,we conclude that Rainbow computational tools for allergenic proteins. Nucleic Acids Res. 2003, and SunUp papaya consumption does not pose any threat to 31,359-362. human and animal health. (17) Gonsalves, D.; Ishii, M. Purification and serology of papaya ringspot virus.Phytopathology 1980,70,1028-1032. •AUTHOR INFORMATION (18) Bradford,M.M.A rapid and sensitive method for the quantita- tion of microgram quantities of protein utilizing the principle of protein- Corresponding Author dye binding.Anal.Biochem. 1976,72,248-254. *Phone: (808)959-4309.Fax: (808) 959-5470.E-mail: savarni. (19) Ling,K.;Namba,S.;Gonsalves,C.;Slightom,J.L.;Gonsalves, tripathi@ars.usda.gov. D. Protection against detrimental effects of potyvirus infection in transgenic tobacco plants expressing the papaya ringspot virus coat Present Addresses protein gene.Bio/Technology 1991,9(8),752-758. Centro Jardin Botanico, Universidad de los Andes, Merida, (20) Sambrook,J.; Russell,D.W.Molecular Cloning;A Laboratory Venezuela. Manual, 3rd ed., 3 vols.; Cold Spring Harbor Laboratory Press: Plainview,NY,2001. (21) Hames,B.;Rickwood,D.Electrophoresis of Proteins:A Practical • REFERENCES Approach;IRL Press:Oxford,U.K., 1981;Vol. 1,pp 13996-14003. (22) U.S.Pharmacopeia.The United States Pharmacopeia 24,2000. (1) Sanford,J.C.;Johnston,S.A.The concept of parasite-derived Simulated gastric fluid, TS. In The National Formulary 19; Board resistance—Deriving resistance genes from the parasite's own genome. of Trustees, Eds.; United States Pharmacopeia! Convention, Inc.: J.Theor.Biol.1985,113,395-405. Rockville,MD,2000;p 2235. (2) Gonsalves,D.;Suzuki,J.;Tripathi,S.;Ferreira,S.Papaya ring- (23) Umezawa, H.; Aoyagi, T.; Morishima, H.; Matsuzaki, H.; spot virus (Potyviridae). In Encyclopedia of Virology, 3rd ed., 5 vols.; Hamada,M.;Takeuchi,T.Pepstatin,a new pepsin inhibitor produced Mahy,B.,Van Regenmortel,M.,Eds.;Elsevier:Oxford,U.K.,2008;Vol. by Actinomycetes.J.Antibiot. 1970,23,259-262. 4,pp 1-8. (24) Laemmli, U. K. Cleavage of structural proteins during the (3) Gonsalves,D.Control of papaya ringspot virus in papaya:A case assembly of the head of bacteriophage T4.Nature 1970,227,680-685. study.Annu.Rev.Phytopathol.1998,36,415-437. (25) Umezawa,H.Structures and activities of protease inhibitors of (4) NASS, USDA National Agricultural Statistics Service. http:// microbial origin.Methods Enzymol.1976,XLV,675-695. www.nass.usda.gov/hi,2009(accessed May 2011). (26) Hiebert,E.;Tremaine,J.H.;Ronald,W.P.The effect of limited (5) Manshardt,R M.'UH Rainbow'papaya.New Plants for Hawaii-1; proteolysis on the amino acid composition of five potyviruses and on the University of Hawaii College of Tropical Agriculture and Human serological reaction and peptide map of the tobacco etch virus capsid Resources:Honolulu, 1999;Vol.1,2 pp. protein.Phytopathology 1984,74,411-416. (6) Tripathi,S.;Suzuki,J.Y.;Carr,J.B.;McQuate,G.T.;Ferreira, (27) Fuchs, R L.; Ream,J.E.; Hammond, B. G.; Naylor,M.W.; S. A.; Manshardt, R M.; Pitz, K. Y.; Wall, M. M.; Gonsalves, D. Leimgruber,R M.;Berberich,S.A.Safety assessment of the neomycin Nutritional composition of Rainbow papaya, the first commercialized phosphotransferase II (NPTII) protein. Bio/Technology 1993, transgenic fruit crop.J.Food Compos.Anal.2011,24(2), 140-147. 11,1543-1547. (7) Astwood, J. D.; Leach, J. N.; Fuchs, R. L. Stability of (28) Gilissen,L.J.W.; Metz, P. L.J.; Stiekema,W.J.; Nap,J. P. food allergens to digestion in vitro. Nat. Biotechnol. 1996, 14 (10), Biosafety of E.coli beta-glucuronidase(GUS)in plants.Transgenic Res. 1269-1273. 1998,7(3),157-163. F dx.doi.org/10.1021/Jf201194r J.Agric.Food Chem.XXXX,XXX,006-000 • Journal of Agricultural and Food Chemistry (29) Ramessar, K.; Peremarti, A.; Gomez-Galera, S.; Naqvi, S.; Moralejo, M.; Munoz, P.; Capell, T.; Christou, P. Biosafety and risk assessment framework for selectable marker genes in transgenic crop plants:A case of the science not supporting the politics.Transgenic Res. 2007,16(3),261-280. (30) Suzuki,J.Y.;Tripathi,S.;Fermin,G.A.;Jan,F.-J.;Hou,S.;Saw, J.H.;Ackerman,C.M.;Yu, Q.j Schatz,M.C.;Pitz,K.Y.;Yepes,M.; Fitch, M. M. M.; Manshardt, R M.; Slightom,J. L.; Ferreira, S.A.; Salzberg, S. L.; Alam, M.; Ming, R; Moore, P. H.; Gonsalves, D. Characterization of inserton sites in Rainbow papaya,the first commer- cialized transgenic fruit crop.Trop.Plant Biol.2008,1,293-309. (31) Kleter,G.A.;Peijnenburg,A.A.C.M.Screening of transgenic proteins expressed in transgenic food crops for the presence of short amino acid sequences identical to potential,IgE-binding linear epitopes of allergens.BMC Struct.Biol.2002,2,1-11. (32) Goodman,R.E.;Vieths,S.;Sampson,H.A.;Hill,D.;Ebisawa, M.; Taylor, S. L.;Van Ree, R.Allergenicity assessment of genetically modified crops—What makes sense?. Nat. Biotechnol. 2008, 26 (1), 73-81. (33) Silvanovich,A.;Nemeth,M.A.;Song,P.;Herman,R.;Tagliani, L.;Bannon,G.A.The value of short amino acid sequence matches for prediction of protein allergenicity.Toxicol.Sci.2006,90(1),252-258. (34) Stadler,M.B.;Stadler,B.M.Allergenicity prediction by protein sequence.FASEB J.2003,17(9), 1141-1143. (35) Ladics, G. S.; Bardina, L.; Cressman, R. F.; Mattsson,J. L.; Sampson,H.A.Lack of cross-reactivity between the Bacillus thuringiensis derived protein CrylF in maize grain and dust mite Der p7 protein with human sera positive for Der p7-IgE.Regul.Toxicol.Pharmacol.2006,44 (2), 136-143. (36) Ladics, G. S.; Cressman, R F.; Herouet-Guicheney, C.; Herman, R A.; Privalle, L.; Song, P.; Ward,J. M.; McClain, S. Bio- informatics and the allergy assessment of agricultural biotechnology products: Industry practices and recommendations. Regul. Toxicol. Pharmacol.2011,60(1),46-53. (37) Hileman,R E.;Silvanovich,A.; Goodman,R E.; Rice,E.A.; Holleschak,G.;Astwood,J.D.;Hefle,S.L.Bioinformatic methods for allergenicity assessment using a comprehensive allergen database.Int. Arch.Allergy Immunol.2002,128(4),280-291. (38) Suzuki,J.Y.;Tripathi,S.; Gonsalves,D.Virus resistant trans- genic papaya: Commercial development and regulatory and environ- mental issues. In Biotechnology and Plant Disease Management; Punja, Z.K.,DeBoer,S.,Sanfacon,H.,Eds.;CAB International:Wallingford,U. K.,2007;pp 436-461. (39) Xia,Y.; Spence, H.; Moore,J.; Heaney, N.; McDermott, L.; Cooper,A.;Watson,D.; Mei,B.; Komuniecki, R.; Kennedy, M.The ABA-1 allergen of Ascaris lumbricoides:Sequence polymorphism,stage and tissue-specific expression, lipid binding function, and protein biophysical properties.Parasitology 2000,120(02),211-224. (40) Gasteiger,E.;Hoogland,C.;Gattiker,A.;Duvaud,S.;Wilkins, M.R;Appel,R.D.; Bairoch,A.ExPASy PeptideCutter tool: Protein identification and analysis tools on the ExPASy server.In The Proteomics Protocols Handbook;Walker,J.M.,Ed.;Humana Press,Inc.:Totowa,NJ, 2005;pp 571-607. (41) Hansen,K.S.;Ballmer-Weber,B.K.;Luttkopf,D.;Skov,P.S.; Wuthrich, B.; Bindslev Jensen, C.; Vieths, S.; Poulsen, L. K. Roasted hazelnuts—Allergenic activity evaluated by double-blind,placebo-con- trolled food challenge.Allergy 2003,58(2),132-138. (42) Mondoulet, L.; Paty, E.; Drumare, M. F.; Ah-Leung, S.; Scheinmann,P.;Willemot,R M.;Wal,J.M.;Bernard,H.Influence of thermal processing on the allergenicity of peanut proteins.J.Agric.Food Chem.2005,53(11),4547-4553. G dx.doi.org/10.1021/jf201 194r I.Agric.Food Chem.XXXX,XXX,000-000 r http://www.nature.com/sci tabl e/knowledge/I i brary/history-of-agricul tur... (4-0 History of Agricultural Biotechnology: How Crop Development has Evolved By: Wieczorek Ania (Dept of Tropical Plant and Soil Sciences, University of Hi at Manoa)&Wright Mark(Dept of Plant and Env Protection Sciences, University of Hi at Manoa)©2012 Nature Education Citation: Wieczorek, A. M. &Wright, M. G. (2012) History of Agricultural Biotechnology: How Crop Development has Evolved. Nature Education Knowledge 3(10):9 0 ,,w cc) Aa •t A�C w -, — -D—<, Ill N lior . ■' F ,, • x •' r • c ` a. ••. . • Ih `. w`, , •f ' M• Have you ever wondered where our agricultural crops come from?And what were they like thousands of years ago, or hundreds of years ago? Our food crops today are in fact very different from the original wild plants from which they were derived. About 10,000 years BC, people harvested their food from the natural biological diversity that surrounded them, and eventually domesticated crops and animals. During the process of domestication, people began to select better plant materials for propagation and animals for breeding, initially unwittingly, but ultimately with the intention of developing improved food crops and livestock. Over thousands of years farmers selected for desirable traits in crops, and thus improved the plants for agricultural purposes. Desirable traits included crop varieties (also known as cultivars, from"cultivated varieties")with shortened growing seasons, increased resistance to diseases and pests, larger seeds and fruits, nutritional content, shelf life, and better adaptation to diverse ecological conditions under which crops were grown. Over the centuries, agricultural technology developed a broad spectrum of options for food,feed, and fiber production. In many ways, technology reduces the amount of time we dedicate to basic activities like food production, and makes our lives easier and more enjoyable. Everyone is familiar with how transportation has changed over time to be more efficient and safer(Figure 1). Agriculture has also undergone tremendous changes, many of which have made food and fiber production more efficient and safer(Figure 1). For example in 1870, the total population of the USA was 38,558,371 and 53% of this population was involved in farming; in 2000, the total population was 275,000,000 and only 1.8% of the population was involved in farming. There are negative aspects to having so few members of society involved in agriculture, but this serves to illustrate how technological developments have reduced the need for basic farm labor. 1 of 7 5/25/2013 7:07 PM wry. r w http://ww w.natur e.com/s c i tab l a/know ledge/l i b rary/hi story-of-agri cul tut... Getting There . raNM M rwKtrtitl wel rR -r�M+.I1 Msrai 1►* �� . ,.., _ Limaillp: 0.4?" r Y Man•1! -e••,, O�r�r •w, grweon r� ilip4 Cr 1a ,.. serlonsi In . .. . its . %:,w'MtXI= 4.z..••■•■••■•Imw. 1 .'"' '" �. . I ,....•..,....•....n=�I e r ; Eft w.wr.i rr.. + eabL fir � r.� Mrw.1 Is�, N.v..s i/r . b".":� n 71: M rees ... ylc Mg r =OW 14011.40 411 cum M �.MM. 1 1 it M/ - . _ wall a MO se i Ali 7 • y4.,ri e_ Figure 1:A timeline showing how human transportation systems have evolved. A timeline showing how human transportation systems have evolved,from primitive,slow,and inefficient vehicles,to modern, faster,and more efficient options.Corresponding advances in agricultural biotechnology are shown below,similarly illustrating how advances changed our ability to develop new agricultural crops. ©2012 Nature Education Courtesy of Ania M.Wieczorek and Mark G.Wright.All rights reserved. This article concentrates on how scientific discoveries and technological developments have allowed us to improve crop development in agriculture. Most people do not realize that among early agriculture developments, really at the genesis of agricultural technology, the ancient Egyptians made wine and made rising dough for bread, using fermentation. A significant event in the development of agriculture occurred in 1492 with the introduction of com, native to the Americas,to the rest of the world, and European growers adapted the plant to their unique growing conditions. At this stage of history, crops were being transported around the world and grown under a diversity of conditions. Agriculturalists started conducting selective breeding of crops before having a thorough understanding of the basis of genetics. Gregor Mendel's discoveries explaining how traits pass from parents to offspring shed new light on the matter. Mendel's work showed that genes separate during the formation of gametes, and unite randomly during fertilization; he also showed that genes are transmitted independently of one another to offspring. This understanding of the way that plants and animals acquire traits form parents created the potential for people to selectively breed crops and livestock. Gregor Mendel's discovery revolutionized agriculture by launching the development of selective cross breeding with a comprehensive understanding of the underlying mechanisms of inheritance. Selective Cross Breeding In traditional plant breeding, new varieties are developed either by selecting plants with desirable characteristics or by combining qualities from two closely related plants through selective breeding. These features may for example be resistance to a particular pest or disease, or tolerance to climatic conditions. Pollen with the genes for a desired trait is transferred from plants of one crop variety to the flowers of another variety with other desirable traits. Eventually, through careful selection of offspring, the desired trait will appear in a new variety of 2 of 7 5/25/2013 7:07 PM http://www.nature.com/scitable/knowledge/library/hi story-of-agriculiur... plants.Traditional plant breeding has produced numerous highly successful new varieties of crops over the centuries. There have also been many less than successful crosses made. In traditional breeding, crosses are often made in a relatively uncontrolled manner. The breeder chooses the parents to cross, but at the genetic level, the results are unpredictable. DNA from the parents recombines randomly, and desirable traits such as pest resistance may be bundled with undesirable traits, such as lower yield or poor quality. The parent plants must be closely related to produce offspring. Traditional breeding programs are time-consuming, often taking decades to produce new viable crop varieties, and labor-intensive. A great deal of effort is required to separate undesirable from desirable traits, and this is not always economically practical. Many potential benefits are lost along the way, as plants that fail to demonstrate the introduced characteristics are discarded. Traditional plant breeding takes on average 12-15 years to produce a new crop variety. Classical Breeding with Induced Mutation Mutations (Figure 2)are changes in the genetic makeup of a plant. Mutations occur naturally and sometimes result in the development of new beneficial traits. In 1940, plant breeders learned that they could make mutations happen faster with a process called mutagenesis. Radiation or chemicals are used to change the plant's DNA, the basic molecular system of all organisms' genetic material. The goal is to cause changes in the sequence of the base pairs of DNA,which provide biochemical instructions for the development of plants. Resultant plants may possess new and desirable characteristics through this modification of their genetic material. During this process, plant breeders must grow and evaluate each plant from each seed produced. is c9 atilt enCe: species do not have exactly the same traits is Traders carried them to Europe and the are permanent changes because they have different alleles. Mediterranean,where mutations occured in the DNA sequence.Mutations to The color of fruits and vegetables is usually or they were crossed with wild varieties. the order of the A,T,G,C bases can result controlled by more than one gene,and there This resulted in the orange carrots we are in different versions of a particular gene. may be several alleles for each gene.The first familiar with.Carrots may be white,yellow, The different versions of a gene are called cultivated carrots came from the area of orange, red, or purple,depending on the alleles.One reason individuals Of Me fame Afghanistan and were purple or yellow. combination of alleles that they inherit \\)1‘11. Figure 2:The effects of genetic mutations in carrots. ©2012 Nature Education All rights reserved. More than 2,500 plant varieties (including rice, wheat, grapefruit, lettuce and many fruits) have been developed using radiation mutagenesis(FAO/IAEA, 2008). Induced mutation breeding was widely used in the United States during the 1970's, but today few varieties are produced using this technique.As our understanding of genetics developed, so new technologies for plant variety development arose. Examples of these that are used today include genetic marker assisted breeding, where molecular markers associated with specific traits could be used to direct breeding programs, and genetic engineering. Some of the significant steps leading to the current state of the art are explained below. 1. Discovery by Watson and Crick: structure of DNA, 1953:Another milestone in the development of 3 of 7 5/25/2013 7:07 PM http://www.nature.com/scitabl e/knowledge/library/history-of-agricultur... understanding of genetics and how genes function, was the discovery of the structure of DNA(the basis of genes), and how DNA works. Two scientists, James Watson and Francis Crick made this discovery(Pray 2008), considered to be one of the most significant scientific works in biology, largely through synthesis of the work of other scientists. Their work contributed significantly to understanding what genes were. 2. Discovering genes that move (transposons):Transposons are sections of DNA-genes-that move from one location to another on a chromosome. Transposons have been referred to as"jumping genes", genes that are able to move around. Interestingly, transposons may be manipulated to alter the DNA inside living organisms. Barbara McLintock(1950) discovered an interesting effect of transposons. She was able to show how the changes in DNA caused by transposons affected the color of maize kernels. 3. Tissue culture and plant regeneration:Another significant development in technology that was important for plant breeding was the development of micropropagation techniques, known as tissue culture (Thorpe 2007). Tissue culture permits researchers to clone plant material by excising small amounts of tissue from plants of interest, and then inducing growth of the tissue on media, to ultimately form a new plant. This new plant carries the entire genetic information of the donor plant. Exact copies of a desired plant could thus be produced without depending on pollinators, the need for seeds, and this could all be done quickly. 4. Embryo rescue: Often when distantly related plant species are hybridized are crossed, the embryos formed following fertilization will be aborted. The development of embryo rescue technology permitted crop breeders to make crosses among distantly related varieties, and then to save the resulting embryos and then grow them into whole plants through tissue culture. 5. Protoplast fusion: Protoplasts are cells that have lost their cell walls. The cell wall can be removed either by mechanical means, or by the action of enzymes. They are left with only a cell membrane surrounding the cell. Protoplasts can be manipulated in many ways that can be used in plant breeding. This includes producing hybrid cells(by means of cell fusion) and using protoplasts to introduce new genes into plant cells, which can then be grown using tissue culture techniques (Thorpe 2007). 6. Genetic engineering: Building on the above discoveries into the 1980s, advances in the field of molecular biology provided scientists with the potential to purposefully transfer DNA between organisms, whether closely or distantly related. This set the stage for potentially extremely beneficial advancement in crop breeding, but has also been very controversial. Genetic Engineering of Organisms The basic structure of DNA is identical in all living things. In all organisms, different characteristics are determined by the sequence of the DNA base pairs. Biotechnology has developed to the point where researchers can take one or more specific genes from nearly any organism, including plants, animals, bacteria, or viruses, and introduce those genes into the genome of another organism. This is called recombinant DNA technology(Watson et al. 1992). In 1978, the first commercial product arising from the use of recombinant DNA technology gene transfer was synthetic insulin. Pig and cattle pancreatic glands were previously the only way of producing insulin for human use. In 1988, chymosin(known as Rennin)was the first enzyme produced from a genetically modified source-yeast-to be approved for use in food. Previously this enzyme for cheese production was obtained from cows' stomach linings. In agricultural biotechnology, changes are made directly to the plant's genome. Once the gene that determines a desirable trait is identified, it can be selected, extracted, and transferred directly into another plant genome (Figure 3). Plants that have genes from other organisms are referred to as transgenic. The presence of the desired gene, controlling the trait, can be tested for at any stage of growth, such as in small seedlings in a 4 of 7 5/25/2013 7:07 PM http://www.nature.com/scitable/knowl edge/library/hi story-of-agri cul tur... greenhouse tray.A breeder can thus quickly evaluate the plants that are produced and then select those that best express the desired trait. Producing new varieties of crops through genetic engineering takes about 10 years on average. HOW does it WL1i AI . I< 7 • Inserting a single gene from the ringspot virus into papaya DNA made the papaya resistant to the virus. Let's take a closer look at how papaya was genetically engineered... r:7'. *Milled eons kern chant: .rte. the s that could give Ow DNA c' ;�'"" papaya resistance. s r Virus DNA Genes that have be 0 moved from one organism to a differ Virus ine organism. tisscyrnes 1proteMn that on example: as dlerslinl jai a gene moves;rpm twere used to cut the gene virus into thi rn a out of the nts ONA at f plant, specific poets. •0 1htnlieIpintslaagNlL „ 041,11° A gene package was created by adding other DNA to both ends `^ r of the viral gene.This DNA is w.— rtsportant for turning the gene ``�� On.A marker gene was also 4 eddedigiiew if the viral gene — 1. wet Ineeeled star es.fuiiy !- •■• . I Siiiiii.- . - ' f ®hlkroscopk gold pellets were s fleeted with the virus gene "'package and shot into papaya cells using an early version of Currently about go%of the pictured here flØ$Vowflfl tre�slallcany .......ir2.1"101011oorodi �`^ the papaya tells went grown ,j ht0 plants and checked to soo if they could resist the virus.The plants did show resistance and grew healthy and strong' Figure 3:The process of genetic engirteerirng in papaya. The process of genetic engineering in papaya.This is the first fruit tree ever genetically engineered(for resistance to a virus that kills papaya plants),conducted by Land Grant Universities(University of Hawaii and Cornell University)in the USA,and licensed to the Hawaii papaya industry for use and distribution. ©2012 Nature Educatiot? Reprinted with permission: Land Grant Universities(University of Hawaii and Cornell 5 of 7 5/25/2013 7:07 PM http://www.nature.com/scitabl e/knowledge/library/tiistory-of-agri cultur... University)All rights reserved. The applications of genetic engineering through recombinant DNA technology increased with time, and the first small scale field trials of genetically engineered plant varieties were planted and in the USA and Canada in 1990,followed by the first commercial release of genetically engineered crops in 1992. Since that time, adoption of genetic engineered plants by farmers has increased annually. While the benefits of genetically engineered crop varieties have been widely recognized, there has been extensive opposition to this technology, from environmental perspectives, because of ethics considerations, and people concerned with corporate control of crop varieties. Comparing Classical Breeding and Crop Breeding Through Genetic Engineering Crops produced through genetic engineering are sometimes referred to as genetically modified organisms. The term genetic modification, and so-called genetically modified organisms (GMOs) is frequently misused. All types (organic, conventional)of agriculture modify the genes of plants so that they will have desirable traits. The difference is that traditional forms of breeding change the plant's genetics indirectly by selecting plants with specific traits,while genetic engineering changes the traits by making changes directly to the DNA. In traditional breeding, crosses are made in a relatively uncontrolled manner. The breeder chooses the parents to cross, but at the genetic level, the results are unpredictable. DNA from the parents recombines randomly. In contrast, genetic engineering permits highly targeted transfer of genes, quick and efficient tracking of genes in new varieties, and ultimately increased efficiency in developing new crop varieties with new and desirable traits. Conclusions: Technology, Progress, Opposition, and Risk Assessment Many different tools are available for increasing and improving agricultural production. These tools include methods to develop new varieties such as classical breeding and biotechnology. Traditional agricultural approaches are experiencing some resurgence today,with renewed interest in organic agriculture; an approach that does not embrace the use of genetically engineered crops. The role that genetic engineering stands to play in sustainable agricultural development is an interesting topic for the future. As with the development of any new technology there are concerns about associated risks, and agricultural biotechnology is no exception.All crops developed using genetic engineering are subjected to extensive safety testing before being released for commercial use. Risk assessments are conducted for these new varieties, and only those that are safe for human use are released. Some concerns arise through people not fully understanding the reporting of risk. Many consider any level of risk unacceptable. Some prefer the application of the precautionary principle when releasing new technology, but this is not a realistic interpretation of what risk assessments tell us(See information presented by Land Grant Universities of the USA). Extensive risk assessment and safety testing of crops developed through the use of genetic engineering has shown that there are no varieties in use that pose risks to consumers. This is not to say that new varieties should not be carefully examined for safety; each case should be considered on its unique merits. References and Recommended Reading American Association for the Advancement of Science.Annual meeting(2011).( ) Land Grant Universities(2011).(link) NERC.Can GM crops harm the environment?(2011).(':. ) 6 of 7 5/25/2013 7:07 PM http://www.nature.com/scitabl e/knowledge/1ibrary/history-of-agri culwr... McLintock, B.The origin and behavior of mutable loci in maize.Proceedings of the National Academy of Sciences of the United States of America 36,344-355(1950). Pray,L.A.Discovery of DNA structure and function:Watson and Crick.Nature Education Knowledge 1,(2008).(?-='k) Thorpe,T.A.listory of plant tissue culture. Molecular Biotechnology 37, 169-180(2007). Watson,J.D.et al.Recombinant DNA,2nd ed. New York,NY:W. H.Freeman, 1992. 7 of 7 5/25/2013 7:07 PM • Ex6B16 Tropical Plant Biol. (2008) 1:293-309 la" DOI 10.1007/s 12042-008-9023-0 Characterization of Insertion Sites in Rainbow Papaya, the First Commercialized Transgenic Fruit Crop Jon Y. Suzuki•Savarni Tripathi•Gustavo A. Fermin• Fuh-Jyh Jan•Shaobin Hou•Jimmy H. Saw• _ n Christine M. Ackerman•Qingyi Yu• CZ* O Michael C. Schatz•Karen Y. Pitz•Marcella Yepes• -4 -mot Z Maureen M. M. Fitch•Richard M. Manshardt• toJ ,--•t Jerry L. Slightom•Stephen A. Ferreira• -- cD""< Steven L. Salzberg•Maqsudul Alam•Ray Ming• Paul H. Moore•Dennis Gonsalves t 1 O CD "' Received: 1 November 2008/Accepted: 17 November 2008/Published online: 10 December 2008 © Springer Science+Business Media,LLC 2008 Abstract Inserts and insert sites in transgenic, papaya understanding the global impact of DNA transformation on ringspot virus (PRSV)-resistant commercial papaya Rain- whole genome structure. The number and types of inserts bow and SunUp,were characterized as part of a petition to were determined by Southern analysis using probes Japan to allow import of fresh fruit of these cultivars from spanning the entire transformation plasmid and their the U.S. and to provide data for a larger study aimed at sequences determined from corresponding clones or se- J.Y. Suzuki•S.Tripathi•M.M.M.Fitch•P.H. Moore S.Tripathi•K.Y. Pitz•S.A. Ferreira D.Gonsalves(®) Plant and Environmental Protection Sciences,College of Tropical USDA-ARS Pacific Basin Agricultural Research Center, Agriculture and Human Resources,University of Hawaii, P.O.Box 4459,64 Nowelo St., Honolulu,HI 96822,USA Hilo,HI 96720,USA e-mail:Dennis.Gonsalves @ars.usda.gov M.Yepes Department of Plant Pathology,Cornell University, G.A.Fermin Geneva,New York 14456,USA Centro Jardin Botanico,Universidad de los Andes, Merida,Venezuela R.M. Manshardt F.-J.Jan Department of Tropical Plant and Soil Sciences,College of Department of Plant Pathology,National Chung Hsing University, Tropical Agriculture and Human Resources,University of Hawaii, Taichung,Taiwan,Republic of China Honolulu,HI 96822,USA S.Hou•J.H. Saw•M.Alam J. L. Slightom Advanced Studies in Genomics,Proteomics and Bioinformatics, AureoGen Biosciences, University of Hawaii, Kalamazoo,MI 49009,USA Honolulu,HI 96822,USA C. M.Ackerman Q.Yu•R. Ming Hawaii Agricultural Research Center, J.H. Saw•M.Alam Aiea, Department of Microbiology,University of Hawaii, HI 96701,USA Honolulu,HI 96822,USA M.C. Schatz•S.L. Salzberg R.Ming Center for Bioinformatics and Computational Biology, Department of Plant Biology, University of Maryland, University of Illinois at Urbana-Champaign, College Park,MD 20742,USA Urbana,IL 61801,USA Springer 294 Tropical Plant Biol. (2008) 1:293-309 quence reads from the whole-genome shotgun (WGS) Introduction sequence of SunUp papaya. All the functional transgenes, coding for the PRSV coat protein (CP), neophosphotrans- In the early 1990's,the very viability of the papaya industry ferase (nptll) and (3-glucuronidase (uidA) were found in a in Hawaii was threatened by crippling crop loss when the single 9,789 basepair (bp) insert. Only two other inserts, aphid-transmitted Papaya ringspot virus (PRSV; [42, 13]) one consisting of a 290 bp nonfunctional fragment of the invaded the industry's major production fields in the region nptll gene and a 1,533 bp plasmid-derived fragment of Puna on the island of Hawaii, where 95% of the state's containing a nonfunctional 222 bp segment of the tetA papaya was being grown. By 1995,PRSV was wide spread gene were detected in Rainbow and SunUp. Detection of throughout Puna causing severe crops losses. Fortunately, the same three inserts in samples representing transgenic previous research had resulted in the development of generations five to eight(R5 to R8) suggests that the three PRSV-resistant transgenic Rainbow and SunUp papaya. inserts are stably inherited. Five out of the six genomic These varieties were released in 1998 and effectively . DNA segments flanking the three inserts were nuclear controlled the virus (reviewed in [7-11, 61, 52, 12]). plastid sequences(nupts).From the biosafety standpoint,no Rainbow is currently the major cultivar grown in Hawaii, changes to endogenous gene function based on sequence accounting for about 70% of the papaya acreage [40]. structure of the transformation plasmid DNA insertion sites SunUp and Rainbow are derivatives of the Ro transgenic could be determined and no allergenic or toxic proteins line 55-1 that was developed by particle bombardment were predicted from analysis of the insertion site and transformation of the red-fleshed cultivar Sunset with the coat flanking genomic DNA. protein(CP)gene of PRSV,utilizing the concept of pathogen- derived resistance (PDR). SunUp was obtained by selecting Keywords Biosafety•Genetically engineered• progenies of line 55-1 that were homozygous for the CP gene. Papaya ringspot virus•Particle bombardment• Rainbow is an F1 hybrid resulting from a cross between Rainbow papaya•SunUp papaya•Transgene SunUp and the yellow-fleshed nontransgenic cultivar Kapoho [35]. It is thus yellow-fleshed and hemizygous for the PRSV Abbreviations CP transgene. Recent work has shown that the resistance of bp base pair Rainbow and SunUp is due to post transcriptional gene CP coat protein silencing (PTGS), and that resistance is affected by CP DSB double-stranded break transgene dosage and the age of the plants. For example, the ELISA enzyme-linked immunosorbent assay increased transgene dosage in SunUp confers resistance to a FAO Food and Agriculture Organization wider range of PRSV strains as compared to Rainbow [56]. (of the United Nations) In the work presented here,detailed sequence analysis of GE genetically engineered the transformation plasmid-derived insertions in Rainbow GUS (3-glucuronidase and SunUp were investigated with the aim of identifying IUIS International Union of Immunological features that might yield clues to factors contributing to the Societies transformation process and the generation of functionally kb kilobase pair stable transgenes. In both Agrobacterium-mediated and MAR matrix attachment regions direct methods for DNA introduction such as particle NHEJ nonhomologous end joining bombardment-mediated transformation, position of integra- nupt-DNA nuclear plastid DNA tion by means of nonhomologous recombination can vary nupts nuclear plastid sequence greatly, affecting both transgene expression and the numts nuclear mitochondrial sequence potential for gene disruption [63, 25, 48, 64]. Thus, a ORF open reading frame greater understanding of transgenesis should help to PCR polymerase chain reaction develop more reliable methods for generation of transgenic PDR pathogen-derived resistance papaya and other plants for crop improvement. PTGS post-transcriptional gene silencing PRSV Papaya ringspot virus SDAP Structural Database for Allergenic Proteins Results T-DNA transferred DNA Topo I Topoisomerase I Identification of the Functional Transgene Insert Topo II Topoisomerase II WGS whole-genome shotgun Previous studies established that the CP transgene confer- WHO World Health Organization ring PRSV resistance, behaved as a single insertion by 1 Springer Tropical Plant Biol.(2008) 1:293-309 295 segregation patterns as determined by PRSV resistance or3 �P enzyme-linked immunosorbent assay (ELISA) along with �- "' cosegregation of transformation plasmid-derived uidA and `5 P13 ; P1 nptll genes as determined by GUS histochemical assays 0. , P12 and ELISA, respectively [58, 33]. To verify the presence, inheritance and stability of the functional transgene across P2 multiple generations, genomic DNA samples of Rainbow P118 .. and SunUp papaya representing generations five to eight (R5 to R8, Table 1) of the original transformant (Ro) were - pGA482GG/cpPRV4 P3 examined by Southern analysis. Probes for the functional —.- 19567 bp transgene insertion represented a subset of probes spanning P11A P4 the entire transformation plasmid (Fig. 1, Table 2). DNA f sequence information for the putative functional transgene • 'y: P10 insertion and flanking genomic DNA was obtained from a 1 ` P5 genomic clone pRb6 isolated from a Rainbow papaya ' P9 genomic DNA library using a CP gene probe [6]. This P8 P7 , P6 ' clone contained a single, contiguous 9,789 bp fragment ra encoding PRSV CP, uidA and nptll genes derived from CIA transformation vector pGA482GG/cpPRV4 [30] flanked by plant genomic DNA (Fig. 2; GenBank Accession no. Fig. 1 Papaya PRSV coat protein (CP) transformation vector and F7467933). positions of 55-1 Southern analysis probes. Target transgenes nptll, and uidA encoding neomycin phosphotransferase,the coat protein To verify that the cloned sequence encompassed the CP respective- functional transgene insertion site, Southern analyses were (CP)gene of PRSV HA 5-1,and 3-glucuronidase(GUS),respective- ly,functional in the plant host as well as vector backbone genes tetA performed using papaya genomic DNA digested with and tetR, and aacC3 encoding tetracycline resistance and gentamycin restriction endonuclease enzymes that would produce frag- resistance,respectively,functional in the bacterial hosts,are shown as ments of predicted size,based on the restriction map of the solid grey block arrows.Arrows indicate orientation of the respective genes. Open boxes represent the nonfunctional 5'and 3'halves of the sequenced region. Restriction enzymes included Bg1II 13-lactamase gene (bla5',bla3', respectively) and plasmid replication which does not digest within plasmid-derived sequences origins(oriV,oriT, and oriColEl).Agrobacterium T-DNA left border and StuI that was predicted to digest once in the functional (LB) and right border(RB)repeats are represented by black boxes. transgene insert portion of the insertion site (Fig. 1, 2). Segments of the transformation vector used for Southern analysis and Seven subfragments were used as probes to represent the WGS database searches are delineated by dotted lines and labeled(P1 to P13). The plasmid segment representing the inserted functional entire functional transgene insertion.To monitor integrity of transgene in papaya line 55-1 and its derivatives (encompassed by the probes, the transformation vector pGA482GG/cpPRV4 probes PI to P7)is marked by a filled semicircle box.Solid triangles indicate positions of the vector's only two StuI sites that were also was fragmented by endonuclease digestion and used as a found in the 55-1 functional transgene insertion as well as the tetA positive control for hybridization. Examples of the South- fragment insertion. Open triangles mark positions of the restriction ern hybridization patterns obtained using R6 and R7 sites for HpaI or NdeI,which were used to fragment the transforma- samples [including hybridization with an equal mixture of tion plasmid used as Southern analysis positive control into three all subfragment probes (probe PA) to confirm the total segments number of hybridized fragment species] are shown in Fig. 3. The number and calculated size of the detected restriction map of pRb6 (Fig. 2, 3, Table 3). Light fragments was consistent with the presence of a single hybridizing bands with apparent molecular weight larger insertion in 55-1 genomic DNA and correlated with the than that correlating to the functional transgene insert were observed with all subprobes and are attributed to partial Table 1 Papaya line 55-1 lines used for insert analysis digestion (see "Methods"). 55-1 line R generation 55-1 functional derivatives no. transgene Identification of Unintended Inserts tested zygosity Two unintended fragments, each comprised of truncated 1 SunUp"I" R6 homozygous gene sequences were detected in line 55-1 (Fig. 4). One 2 Rainbow R7 hemizygous unintended insert was a truncated, nonfunctional copy of 3 SunUp"II" R5 homozygous 4 SunUp"III" R8 homo nptll flanked at either end by its own unique genomic DNA zygous borders that was initially revealed from whole-genome Springer 296 Tropical Plant Biol. (2008) 1:293-309 Table 2 Probes encompassing transformation plasmid pGA482GG/cpPRV4 Probe Description Start End Total position position length(bp) 1. PA Functional transgene insert;Mixture of probes P1 -,P7;excludes probe P6-1. 173 9,955 9,783' 2. P1 Noncoding sequence between transgene insertion left border and uidA 3'end 173 2,005 1,833 including uidA nopaline synthase terminator(T-nos) 3. P2 uidA structural gene 2,006 3,817 1,812 4. P3 Noncoding sequence between uidA 5'end and 3'end of the PRSV CP 3'end. 3,818 5,198 1,381 Includes uidA, cauliflower mosaic virus 35S(35S)promoter(P-35S)and PRSV CI 35S terminator(T-35S) 5. P4 PRSV CP structural gene 5,199 6,113 915 6. PS Noncoding sequence between PRSV CP gene 5'end and nptll 3'end.Includes 6,114 8,075 1,962 PRSV cp P-35S,and nptll Tnos. 7. P6 nptll structural gene 8,076 8,897 822 8. P6-1 nptll structural gene partial sequence not contained in a second,290 bp(8,129 to 8,417 8,897 481 8,416)nptII insertion sequence. 9. P7 Noncoding sequence between nptll 5'end and transgene insertion right border. 8,898 9,955 1,058 Includes nptll nos promoter(P-nos) 10. PB Mixture of probes P8->P13,excludes probe P9-1,P9-2,P10-1 9,956 172 9,784 11. P8 Vector sequence between functional transgene insertion right border and tetR 9,956 11,444 1,489 12. P9 651 bp tetR structural gene+105 bp intergenic region between tetA+tetR. 11,445 12,200 756 13. P9-1 tetR, C terminal fragment nonhomologous to tetA fragment insert and P11A. 11,445 11,931 487 14. P9-2 100 bp tetR N terminal fragment+105 bp intergenic region between tetA+tetR 12,000 12,200 201 nonhomologous to tetA fragment insert and P11A. 15. P10 tetA structural gene 12,201 13,400 1,200 16. P10-1 tetA structural gene partial sequence excluding the 222 bp tetA insertion in line 55-1. 12,201 13,178 978 17. P11A Vector sequence from 3'end of tetA found in tetA insertion of 55-1 13,401 14,690 1,290 18. P11B Vector sequence adjacent to that of probe 11A but not including aacC3, 5'. 14,691 17,139 2,449 19. P12 aacC3 structural gene 17,140 18,000 861 20. P13 Vector sequence between aacC3 3'end and functional transgene insertion left border. 18,001 172 1,739 a Total calculated length encompassed by PA is based on the sequence of the transformation plasmid and is six nucleotides shorter than the sequence of the functional transgene insert. A B ' 11,236 by 7,601 bp 3,725 by 14,622 by 9,960 by i 4,662 bp O <n 8,052 by M N °o a,N CO N CC0 N CO CD OD W C s a 13 v" m 9 a mm CO z z xa CO m m E23931 ' IZ1 Cli Functional transgene ' P1 P2 P3 P4 P5 f P6 P7 insert/probes pRb6-15,595 bp Fig. 2 55-1 functional transgene insert DNA sequence map derived as well as intervening sequences (probes P1, P3, P5 and P7) are from clone pRb6. Solid box arrows denote orientation of coding marked. DNA segments not encompassed by probes represent sequence for functional transgenes uidA,PRSV CP and nptll and are flanking papaya genomic DNA. DNA fragments and fragment sizes each flanked by floating open and solid boxes representing transgene generated from complete Bglll and StuI double digestion are labeled transcription elements, the 35S and nopaline synthase promoters (P- `A'(detected by probes P1 to P5)or'B'(detected by probes P5 to P7) 35S and Pn, respectively) and the 35S and nopaline synthase and their sizes are indicated in basepairs(bp).Detected fragments and transcription terminator elements (Ts and Tn, respectively). DNA respective sizes derived from complete digestion are represented by elements unrelated to transgene function including a truncated (3- bold lines and lettering, fragments and sizes derived from partial lactamase(bla),ColEl and V origins of replication(ori ColEl and ori, digests are represented by dotted lines with nonbold labeling. respectively) and transfer DNA right border repeat(RB) are labeled Fragment sizes of genomic DNA generated by Bg11I digests alone and shown as anchored open boxes. Southern analysis probes are shown at the right. Bg111 sites labeled with asterixes are non- spanning the entire functional transgene insert (see Fig. 1, Table 2) canonical BgllI sequences including probes for structural gene sequences(probes P2,P4 and P6) Springer i Tropical Plant Biol. (2008) 1:293-309 297 shotgun (WGS) sequence reads of SunUp papaya (Fig. 4a) not shown). Six additional papaya WGS unassembled [39].The nonfunctional nptll sequence comprises 290 bp of sequences with vector DNA-like sequences were also the 3' end of the 822 bp nptll coding sequence (GenBank detected by MUMmer only when untrimmed sequences Accession no. FJ467932). The nptll gene probe was the were included in the analysis. However, the existence of only one among the functional transgene insert probes that these potential inserts could not be unequivocally verified detected a second distinct insert site (Fig. 3, Table 3). A by PCR, nor did Southern analysis using probes spanning subprobe (probe P6-1) which lacked sequences the entire transformation plasmid detect novel hybridizing corresponding to the nonfunctional nptll fragment detected bands that could potentially correspond to these sequences. only the band correlating with the functional transgene insert as predicted, suggesting that the nptll fragment Identity of Genomic DNA Flanking the Inserts; shotgun sequence represented the second nptll insert Preponderance of Plastid DNA-like Sequences observed by Southern analysis (Fig. 3, 4a, Table 2, 3). The second unintended insertion, a truncated, nonfunc- Functional Transgene Insert tional 222 bp tetA gene fragment and flanking plasmid vector DNA totaling 1,533 bp was detected in preliminary A database search using Blastn analysis of the DNA Southern blot analyses using probes covering all remaining sequences flanking the inserts was conducted to investigate segments of the transformation vector outside of the the possible identity of sequences at the insertion sites. functional insert sequence (Fig. 1),represented by compos- Interestingly, genomic DNA sequences flanking the ite probe PB (Table 2). Sequence information correlating functional transgene were found to share near identity to with the tetA hybridizing fragment was obtained from a papaya plastid(chloroplast)DNA(GenBank Accession no. clone 66B4 identified from a BAC library of SunUp NC_010323; Fig. 6a). Plastid DNA is normally found in genomic DNA using a tetA probe (Fig. 4b; GenBank and comprises the genome of the semi-autonomous Accession no. FJ467934). Southern hybridization bands organelle,the chloroplast and is relatively highly conserved correlating with the tetA fragment insert appeared to among higher plants [50]. Transformation of the plastid correspond to one insertion (Fig. 5, Table 4). Although genome could be ruled out, since the transgenes in 55-1 are the detected fragment sizes suggest the absence of digestion known to segregate in a Mendelian fashion, whereas, the at several restriction sites predicted by the tetA fragment plastid is normally maternally inherited in papaya and its insert sequence,the general architecture of the insertion site relatives [62]. Therefore, it could be concluded that the is confirmed by the patterns of the various probes DNA flanking the insert were plastid DNA-derived hybridizing to the insert locus. Hybridization patterns sequences in the nuclear genome similar to the numerous obtained using 55-1, R5 and R8 genomic DNA were sequences documented in other plants as well as non- identical to that of R6 and R7 samples for all inserts photosynthetic, plastid containing eukaryotes and recently identified, indicating that the three identified were stable referred to as nuclear plastid sequences (nupts) or nuclear over multiple generations (data not shown). plastid DNA (nuptDNA) [47, 43, 59]. With the exception of the probe for aacC3 (P12), no The nupts sequences flanking both sides of the func- distinct transgenic line-specific hybridization bands were tional transgene insertion appeared to derive from the same observed using transformation vector backbone probes region of the papaya plastid genome including trn and rps outside of the tetA gene and flanking vector sequence. genes encoding tRNAs and a component of the plastid Since Southern hybridization patterns obtained with the small ribosome, respectively, and part of the ycf3 gene aacC3 probe were very light and indistinct compared to involved in photosystem I assembly [44]. As these those observed with probes to the known inserts and could sequences derive from the plastid and are expressed there not be detected with various independent approaches (see via a prokaryotic-like or phage-like gene transcription [29, "Methods"), it was concluded that the observed hybridiza- 60] system and a prokaryotic-like translation [51] system, tion bands with the aacC3 probe did not represent a true this and other nupts are not expected to represent functional insertion. or expressed genes. All inserts were confirmed by all-vs-all sequence alignment using MUMmer[27]of the transformation vector Nonfunctional nptll Fragment Insert pGA482GG/cpPRV4(Fig. 1; Gustavo Fermin,unpublished vector sequence) to the papaya WGS sequence data base. The genomic DNA flanking both borders of the nptll Polymerase chain reaction(PCR)products of expected size fragment also showed identity to papaya plastid DNA were obtained using primers spanning the flanking plasmid sequences (Fig. 6b). The sequences showed homology to DNA/genomic DNA insert junctions at all three inserts plastid genome sequences ndhG and atpB, E encoding verifying the insertions and insertion site sequences (data components of protein complexes, NADH-specific dehy- Springer 298 Tropical Plant Biol. (2008) 1:293-309 PA P1 P2 P3 0 U BglIl BglIl+Stul Y E BgIII BglII+Stul 8 u 89111 BglIl+Stul d o BglIl BgIII+Stul Y “5 -o 3 — s 3 — ° -o o 3 - 0 3 – ro ° o 3 - 0 3 – `m -°° 2 3 – 0 3 - E ni so a s° °- E m ° a s z ° a E s d ° o- t iv ° °- E s m ° a s t o a z N O N C O N C E a C C a C C z N Q C C a C C z E a C C a C -a C z ro .� m Z ro m m ° m ° z ro ro m ° ro m z m O n Y u) cc In Y CO u: CO 0 a Y Cn 2 (n Y CO CC CO 0 a Y [n CC CO Y Cn CC CO O a Y CO 2 CO co V1 co fn 23.1 , f„ O a x a 9.4 o ar••••• o + • .i... o 6.6 ■ A •A :r.►iA 14 YA 4.4 — o ,r gir 2.0 Fr » .. • a a . i ■` 0 P4 P5 P6 P6-1 o BglIl 89111+Stul 8 E BglIl BgIII+Stul BglIl BglIl+Stul d c BglIl Bg111+Stul Y U -, O ` O y O ro -° 0 3 – 0 3 - ro ° 3 - 3 - m U 3 - 3 - ro ° 3 - 3 - 6 N o y 2 o y - E E o y s o °N s % E E o - o y a° % E E o y a o °N _° Z 2 N S a J N 0 a S Z 2 a C C C a C C C z N a C C S a C a C z N a C C S a C it S C a Y Cn cc co Y Cn CC UJ ro O N O (Q O r Z N ro O N O f0 O td O Z ro ro O O ro O N O � a Y cn 2 (n Y N CC fn cn a Y to OC cn Y (n CC CO 0 a Y N 2 (n Y CO CC CO 23.1 .P. 4 9.4 0 + + OOP a + a •A 6.6 ■ 46-• ° '' I o .4.80.44.1. . .,*o a».ap.o '` 4.4 '-•B • 2.3 411i IMO 2.0 w •.• 0 P7 Y o BgIII BglIl+Stul U < L E O N f D c N -2 D Z N N S J O ro J a Y (!1 cc co Y N Cr CO 23.1 9.4 + soMPe t 6.6 4.4 ... o --•B 2.3 ••• 2.0 •• Springer Tropical Plant Biol. (2008) 1:293-309 299 A Fig. 3 Southern blot analysis of papaya 55-1 using all probes segments found within the 1, 706 bp non plastid DNA-like spanning the functional transgene insertion. Transgenic samples sequence showed identity to entries in the database. Blastn Rainbow and SunUp were R7 and R6 generation, respectively. Kapoho and Sunset were used as nontransgenic controls. Plant DNA analysis revealed that one of the segments located proximal samples were treated with either Bg111 or BglII and StuI. Probes are to the plasmid DNA insert junction (flanking nucleotide described in Fig. 1, 2 and Table 2. Plasmid control is plasmid 518 to 557)had identity to two different database entries, a pGA482GG/cpPRV4 digested with Hpal and Ndel(hybridized bands very short homology (39 of 40 bp) to a sequence found in are labeled by`+').DNA marker sizes are shown at the left in kilobase pairs (kb). Solid circle denotes functional transgene band resulting the Vitis vinifera(grape)genome(GenBank Accession nos. from complete digestion. Open circles denote functional transgene AM461950.2, AM470652.2, AM467675.1) and alignment bands resulting from partial digestion. `A', `B' denotes completely of the same sequence(38 of 39 bp)to a noncoding segment digested halves of the functional transgene insertion resulting from the associated with a carrot, cytoplasmic male sterility (CMS) addition of StuI. Solid and open squares represent putative complete and partial digests,respectively,of a fragment recognized by probe P6 line atp6 gene(GenBank Accession no. AY007817.1). The (nptll) that is distinct from the nptl7 of the functional transgene second segment, a 264 bp region (flanking nucleotide 1, insertion. The symbol a marks the band corresponding to this nptll 167 to 1, 431) distal to the plasmid DNA insert junction (nonfunctional) fragment following additional treatment with StuI. The symbol "" indicates bands resulting from crosshybridization of showed significant homology to gag pol retrotransposon uidA Tnos to nptil Tnos. The symbol `**' indicates band resulting like sequences found in Oryza (for example, GenBank from crosshybridization of CP P35-S to uidA P35-S Accession no. AAQ56390.1)by blastx analysis, but also to related genomic DNA in Oryza and Malus species, Glycine max and Lotus japonica by tblastx analysis. drogenase and ATPase complex, respectively [50], that Evidence for Genomic Rearrangement at Insertion Sites function within the plastid. The DNA sequence of the insertion sites not only allowed Nonfunctional tetA Fragment Insert identification of potential genes flanking the insertion, information helpful in assessing the general impact of One of the genomic DNA sequences flanking the tetA transformation on the genome of papaya but it also revealed fragment insert also showed identity to a plastid DNA clues to the process of transgene integration. Genomic sequence,ycf2 (Fig. 6c). The function of ycj2 that encodes DNA sequence information, for example indicated that one of the largest open reading frames in plastids is unclear, rearrangement occurred to different extents at each insertion but appears to be essential for cell viability in the context of site(Fig. 6a,b,c). This could be inferred since the sequence its function within the plastid [4]. Only one out of the six and sequence order of plastid genes from which nupts are genomic sequences flanking the three inserts detected in predicted to derive are highly conserved and flanking line 55-1 was comprised of non plastid DNA-like sequence sequences exhibited near identity to the papaya chloroplast and was found flanking the tetA fragment insert. Two genome. Table 3 55-1 Southern hybridization band calculated molecular weight(kb)summary for transformation plasmid pGA482GG/cpPRV4-derived probes encompassing the functional transgene insertion Functional transgene insert probes Sample Band designations A 1 2 3 4 5 6 6-1 7 55-1:BglII o 14.8 14.6 14.9 15.2 14.6 14.5 14.6 14.9 15.2 • 10.8 11.2 11.3 11.5 11.1 10.9 10.9 11.2 11.4 • 6.9 7.0 55-1:Bg1II1Stul o 10.0 9.9 10.7 11.1 10.3 10.0 o 8.1 8.1 8.5 8.6 8.0 8.1 •A 7.0 7.2 7.5 7.6 7.3 7.1 o 6.7 ■a 5.1 5.2 o 4.6 4.7 4.7 4.7 4.9 •B 3.5 3.7* 3.6 3.7 3.7 3.7 Plasmid:Ndel/Hpal + 5.8 5.9 + 3.3 3.4 3.3 3.3 3.3** + 10.8 10.8* 10.9 10.9 10.7 11.0 10.8 11.0 'Band symbols and asterixes are defined in Fig.3. 'l Springer ' 300 Tropical Plant Biol. (2008) 1:293-309 A a i fi -7,000 bp -5,200 bp ' -6,700 bp o N Of De C lA CO m m insert 7''11 492 probe template 822 , . i e p 1 nptll fragment insert probes , P6 Po-' WGS sequence-1481 bp B A B 1- ^4,00 bp -3,800 bp -7,600 bp -1 -8,600 bp -5,200 bp N ^3,800 bp o 0 M N t 4) l m m m m m insert 97-163 979 1 1 probe template r — 1,zoo tetA x_-_. ,....:, -s 651 tetA fragment insert probes I P'°_1 :P'z, Il P11A P10 09 BAC 66B4-9,538 bp Fig.4 55-1 unintended,nonfunctional insert DNA sequence maps.a BglII and StuI double digestion are labeled`a'and`(3'(`a'represents nptll fragment insert derived from WGS sequence of SunUp papaya.b the completely digested nptll fragment insert detected by probes 6 but tetA fragment insert derived from SunUp bacterial artificial chromo- not 6-1; 13' represents an undetected fragment), 'A' (for tetA some (BAC) clone 66B4 sequence. Solid box arrows denote fragments detected by probe P11A)or`B'(for tetA fragments detected orientation of structural genes for nptll, tetA and tetR. Solid box by probes P9, P10 and P11A). Fragments representing major bands arrows are numbered to denote size of the original gene and indicate attributed to complete digestion are labeled with bold lettering,minor the portion represented in the inserts. DNA derived from the fragments thought to be derived from partial digests are labeled with transformation plasmid are marked by brackets labeled `insert', the nonbold lettering.Fragment sizes of genomic DNA generated by BglII remaining segments represent flanking genomic DNA. Segments with digests alone are shown at the right.Fragment segments are shown as no sequence information are shown as hatched boxes. BglII sites horizontal dotted lines and marked in base pairs (bp) with "-" to marked with single asterixes denote proposed endonuclease restriction indicate that size values and map positions are estimated wholly or in sites based on calculated lengths of detected fragments.BglII site with part on DNA blot analysis data. A segment of the transformation a double asterix marks a position which cannot be verified due to plasmid within the region encompassed by probe P1 lA (open and ambiguous nucleotides in the surrounding sequence data.Numbers in solid box)contains a 21 bp sequence that was repeated(denoted by the `probe templates' denote relevant structural gene sequence position. open box) and transposed in the tetA fragment insert during Probe segments (described in Fig. 1, Table 2) are matched to their transformation. The solid box is a 68 bp sequence that is found in corresponding template and target sequences by vertical dotted lines. probe P11A and the corresponding segment of the tetA fragment insert DNA segments not matching to probes represent flanking papaya of 55-1, and nearly identically (64 of 68 bp) in probe P9 (the tetR genomic DNA. DNA fragments and fragment sizes predicted from gene)but not probes P9-1 and P9-2 In the case of the functional transgene insertion, papaya plastid genome. Finally for the tetA fragment insert, sequences at both flanks of the insert derive from the same it is unlikely that the insert landed at the exact border region of the plastid genome but are inverted with respect between nupts and non-nupts as the DNA sequence to each other. A duplicated region found in both flanks of indicates. Thus, integration of the tetA fragment likely the functional transgene insertion appears to be a footprint involved rearrangement or rejoining of DNA ends.Whether of this inversion. In the case of the nonfunctional nptll we assume that these nupts were present in the genome fragment insert,plastid-like nupts are found on both flanks prior to bombardment or not, this result thus suggests that of the insert; however, the sequences are from completely genomic rearrangement including joining of disjointed ends different positions based on their arrangement on the occurred upon insertion at each site. The tetA insert is Springer Tropical Plant Biol. (2008) 1:293-309 301 unique among the inserts in that it also exhibits rearrange- filler sequences have been attributed to illegitimate recombi- ments that occurred among plasmid sequences. Rearrange- nation in plants[25,26].Both filler DNA and microhomology ment of transforming sequences without the presence of predictions were based on the ability to predict sequence ends intervening genomic DNA as occurs at the tetA fragment and were thus enabled by the near identity of the flanking insertion site has been proposed to occur extrachromaso- nupts to sequences in the plastid genome. mally prior to insertion and is the first step in a model describing a two-phase mechanism for the integration of Insertions and Flanking Sequences do not Code foreign DNA into the chromosome [24]. for Allergens or Toxins Association of Topoisomerase I Sites, Filler Sequences Evidence that the inserts do not encode novel toxic or and Microhomology at Insert Junctions allergenic proteins was addressed by first identifying the protein encoding capacity via open reading frame (ORF) To gain further insight and clues as to the various processes analysis of the inserts, insert junctions and flanking that resulted in plasmid integration in papaya line 55-1,the genomic DNA sequence (see "Methods"). For the func- junction regions of each of the inserts were scanned for two tional transgene and tetA fragment insert, ORFs spanning DNA elements, recognition sites for endogenous DNA the insert and at least 1.0 kb beyond the insertion borders repair enzymes topoisomerase(Topo)I and Topo II, shown were analysed. In the case of the nptll fragment, ORFs previously to be associated with particle bombardment-and were determined using the available contig sequence Agrobacterium-mediated transformation integration sites obtained from the WGS sequence of SunUp papaya. [46, 2]. Integration of exogenous DNA such as a transgene None of the ORFs derived from genomic DNA or into chromosomal DNA is thought to occur by illegitimate junction sequences for any of the three transformation recombination, a process that implicates the involvement of plasmid derived inserts aligned with known toxic or double-stranded break(DSB)DNA intermediates and DNA allergenic proteins in the protein sequence database nor repair enzymes [15, 63, 48]. did any show similarity to known toxic proteins based on Sequences which matched the recognition site for Topo I criteria outlined by the special joint commission of the were located at functionally relevant positions at the Food and Agriculture Organization (FAO) and the World insertion junction border of the functional transgene and Health Organization(WHO) [5] (see "Methods"). nptll fragment insertion, and only the internal plasmid DNA recombination borders of the tetA insertion (Fig. 7). The external, insert/genomic DNA junctions of the tetA Discussion fragment insert do not appear to have Topo I sites,however, it is the only insert whose left and right sequence ends are As part of a larger study to understand impact of direct repeats,derived from duplication and transposition of transformation on whole genome structure [39], each insert part of the plasmid sequence. and insert site was examined. Southern analysis, the Transgenes have often been reported to insert in scaffold or standard method of transgene insert analysis was the basis matrix attachment regions (MAR)of the genome which have for detection of transformation plasmid-derived inserts in A/T rich characteristics and are associated with Topo II papaya line 55-1 derivatives. The fact that Southern recognition sites [54, 46, 34]. However, DNA flanking all of hybridization patterns correlated in general to available the inserts were scanned for the presence of MAR-like sequence information corresponding to the insert sites from sequences [28] and no such sequences were detected. The plasmid and BAC genomic clones and the WGS sequence insertion site junction sequences did possess several other of SunUp papaya supports the view that Southern analysis features that have been attributed to illegitimate recombination is indeed a sensitive and valid method to detect transfor- processes. In the case of the functional transgene insertion, mation-derived inserts. intervening "filler" sequence that cannot be ascribed to the Although the WGS sequence analysis failed to physi- flanking DNA nor to the inserting DNA was found at either of cally link the three identified insertions, they were present its insert junctions in addition to the Topo I sites (see in samples spanning generations R5 to R8, thus appear to "Methods"). Filler sequences are thought to occur as a result be stably inherited together. Although linkage has not been of nonhomologous end joining(NHEJ) [14]. The Topo I sites physically established, multiple insertions separated by found at the junctions of the other inserts do not contain filler genomic DNA at a single locus was reported to be a sequences, but instead exhibit a two to three base pair common occurrence in biolistic (particle bombardment) microhomology between sequences predicted to have been based transformation [24, 41, 3]. On the other hand, a present at the ends of both contributing DNA ends prior to second papaya line, 63-1, isolated from the same trans- insertion and formation of the junction. Microhomology, like formation experiment as line 55-1, behaves as if it has Springer 302 Tropical Plant Biol. (2008) 1:293-309 PB P8 P9 P9-1 0 Y o Bglll BgIII+Stul Y o BgIII BgIll+Stul y o Bgill Bglll+Stul Y o ;gin' BgIII+Stul '� v o 3 — 0 3 — A 0 — 0 — tc 1 0 — 0 3 — to a ° — ° 3 Er a L m �° °- E L N �° a L N 90 . L d a r 1111 �o %_I E s o_ .c m a Q o a C c ° c .. c a w ° ° c ° c _ < m a c S ° . c a E a c a c - c z m to m > > m Z to tto > lQ 5 /(1 ;!2 ,§ Z rt ° o too gay O m o Z ! 0 0. Y co cc co u) tr V) oz.Y fA 2 W o.Y c0 U1 Y wiry) 4 Y (A 2 (0 (/l Q (n 23.1 9.4 I 2.3 `•' 2.0 '"' P9-2 P10 P10-1 P11A E o N Bg III o BgIII BgIII+Stul Y — 3 —0 m o° P p a ° °' n o a s o Bgll Bglll+Stul o l E Y o BgIII Bglll+Stu' - 3 - m a r d 9a Bp 0 glN ll+�tua l Z to o ° _ t _ �Q ° m � P a r N 9 a Q o o N � a L aN ; a Q ,,Ti l a O Y to 0 t� Cl) � Cl) Cl) Y n tN o N J 2 o td A a A U C Cl) Y u o . n Cl) (n 23.1 3�m A 9.4 wA+ ` � ��' �+ ::' r. 6.6 ...•B 2.3 w. Y i r 2.0 r ""• I ii P12 0 P13 Y o BgIII BglIl+Stul Y o BgIII BgIII+Stul U U E N O N .. O N = E E O N O N C Z ro P a P m P m A Z m m I 'm P ro f .� 0 a Y c n 0. (0 Y c/7 0. N 0 �. Y w 0. 0 cn 0. cn 23.1 •• - 9.4 6.6 $ ♦ + 4.4 2.3 +eR 2 it .0 400 Springer Tropical Plant Biol. (2008) 1:293-309 303 Fig.5 Southern blot analysis of papaya 55-1 using all probes outside in close proximity to each other as discussed above and of the functional transgene insertion.Plant and plasmid DNA samples coincidentally within a cluster of nupts, such as have been are as described in Fig. 3. Probes are described in Fig. 1, 4 and Table 2. Solid diamonds denote tetA fragment band resulting from reported to occur at least in the nuclear genome of rice [37]. complete digestion, open diamonds denote the corresponding bands A survey of 1,000 T-DNA insertions obtained by resulting from partial digestion. `A', `B'denote two halves of the tetA Agrobacterium-mediated transformation in Arabidopsis fragment insertion band resulting from the addition of StuI.Diamonds marked by `***'denote hybridization due to a 64 bp identity between revealed that only 0.6% inserted in nupts or nuclear sequences found in probes P9 and P11A(see Fig.4b).Solid triangles mitochondrial sequences (nums) [53]. In another study mark putative bands resulting from hybridization with probe P12 involving analysis of transgenic Arabidopsis produced by (aacC3). Bands common to both nontransgenic and transgenic particle bombardment, one insertion locus of three trans- samples with probes PB, P9, P9-1, P10, P10-1 and P11A represent nonspecific hybridization formed plants was flanked by nupts [46]. These reports indicate that transgene insertion in nupts can occur by both particle bombardment and Agrobacterium-mediated trans- more than one transgene functional for PRSV resistance formation. However, in the future, it would be helpful to that segregate from each other [49, 57] suggesting that analyze a larger number of transgene insertion sites linkage of multiple inserts is not necessarily a charac- produced by particle bombardment so that the relative teristic feature of transformation by particle bombardment frequency of insertion in nupts can be estimated and in papaya. compared to those produced by Agrobacterium-mediated The fording that five of the six sequences flanking the transformation. three identified inserts were nupts was surprising in that Formally,we cannot discount the possibility that the nupts nupts represent only a fraction, albeit a surprisingly large flanking the inserts in 55-1 papaya DNA were also a result of portion of the papaya nuclear genome (0.28%) [39]. DNA the transformation event as has been determined at the base composition is often cited as a possible basis for insert transgene insertion site in a GE corn line obtained by particle site selection since transgenes have been reported to bombardment [17]. The actual sequence of the 55-1 preferentially insert in A/T rich regions such as MAR sites preinsertion site was not determined, although PCR ampli- whether they are delivered by Agrobacterium- or particle fication products corresponding to sequences flanking the bombardment-mediated transformation [46, 2]. There may inserts were in fact obtained from both 55-1 line as well as be additional or alternative reasons for the preponderance of nontransgenic progenitor papaya DNA samples (data not nupts flanking the plasmid inserts of 55-1 since the overall shown). However, it can be inferred at least that the flanking base composition of papaya chloroplast DNA is indeed AT- nupts are probably not ancient inserts since they are nearly rich with a G-C content of 37% (GenBank Accession no. identical to corresponding sequences in the papaya plastid NC_O10323.1) but is similar to the base composition of genome, whereas relatively older inserts are predicted to papaya nuclear genome with an overall G-C content of exhibit lower plastid DNA identities due to fragmentation 35.3% [39]. One possible explanation for the preponder- and mutation that occurs over time [19, 37, 16]. ance of plastid DNA-like sequences surrounding the Although transgenesis is viewed as an unnatural event, insertion sites might be that the plasmid fragments inserted the existence and diversity of nupts even among non- Table 4 55-1 Southern hybridization band calculated molecular weight(kb)summary for all transformation plasmid pGA482GG/cpPRV4 probes outside of functional transgene insertion sequences Vector backbone probes Sample Band designations B 8 9 9-1 9-2 10 10-1 11A 11B 12 13 55-1:Bglll 0 8.7 8.8*** 8.9 8.7 8.6 • 7.7 7.7*** 7.8 7.6 • 7.3 55-1:BgQUStuI • 7.3 0 5.0 5.2 *A 4.0 4.1 *B 3.7 3.7*** 3.8 3.8 Plasmid:NdeI/Hpal + 5.6 5.9 5.9 5.9 + 10.9 10.6 11.1 10.8 10.9 11.0 10.9 10.7 11.0 'Band symbols and asterixes are defined in Fig.5. l Springer 304 Tropical Plant Biol.(2008) 1:293-309 Functional transgene(tnT,r p s4,tmS,ycf3) (tmL,trnF) � - _ 9,789 by _ 4,011 bp 1,795 bp (ycf3 tmS,rps4,trnT trnL, trnF) nupts?/plastid - — — B nptll (ndhG) fragment (atpB,atpE) —p 363 bp 290 bp 828 bp C Vector/tet A (ycf2) Y (atp6) (gag/pol) 6,299 bp 1,533 bp 1,706 bp Vector X Y DNA --N ?lal 'It€ Fig.6 Structure of transformation insertion sites in the papaya 55-1 encoding part of the trnL gene duplicated in the left and right insertion line genome. a Functional transgene insert. b Nonfunctional nptll borders. Direction of the block arrows indicate orientation of the fragment insert. c Nonfunctional tetA fragment insert. Solid arrows duplicated nupt DNA region as well as the flanking nupt gene represent insertions and orientation with respect to the plasmid sequences with respect to their relative positions in the homologous sequence(functional transgene)or gene orientation(vector/tetA,nptll region of plastid DNA (ptDNA). Gray arrowheads in c represent a fragment insertion).Dashed lines represent plastid DNA-like nuclear 21 bp vector sequence that is duplicated and transposed in the same genome sequences flanking the transgene insert. Gene sequences orientation along with adjoining transformation vector sequences(X) found in the flanking DNA are identified in parentheses.Dotted line to a position flanking a second, adjacent segment (Y). The inserted represents flanking sequences that are not plastid DNA-like. Block vector DNA contains a truncated tetA gene (shaded block arrow). arrow in a indicates a 523 bp sequence of flanking genomic DNA Lines representing insertions and flanking DNA are not drawn to scale transformed plants of the same species indicates that the homology to members of the gag/pol family of retrotrans- process, at least of exogenous DNA integration into the posons. The significance and origin of the sequence with genome is a natural and continually occurring event [36] homology to the carrot atp6 associated segment is unclear and does not appear to cause wholesale damage to genome since no homology to other plant mitochondrial sequences function. The integration process of plastid DNA into the in the database was found and since the relevant sequence nucleus also seems to share properties with that of transgenes. was derived from a CMS line. On the other hand, the For example, microhomology as has been observed at the observation that a second segment of the tetA fragment junctions of the tetA and nptll fragment insertion sites in 55-1 insert showed significant homology to gag pol retrotrans- has also been found at the junctions of nupts in non- poson-like sequences is interesting in that retrotransposons, transformed plants [18]. Filler and repeat sequences, Topo I as a class of DNA elements comprise a large proportion of and rearrangement at the transformation plasmid fragment the papaya nuclear genome [39], but are also found in the insertion sites observed in this study, are also processes that mitochondria of papaya as well as other plants [23, 39]. have been previously described for natural DNA repair Interestingly, retrotransposons are inserted in a large processes as well as for insertion of exogenous DNA. proportion of nupts of rice and are thought to play a role Only one transgene bordering genomic sequence adjoin- in the fragmentation of those sequences [16]. Thus, the ing the tetA fragment insertion was not homologous to presence of sequences resembling remnant retrotransposon- nupts; instead one segment of this sequence had short like sequences in close proximity to nupts as found in the homology to both a grape genomic DNA sequence of tetA fragment insertion is not unprecedented and supports unknown function as well as an atp6 associated sequence the view that the insertion site may be in a region of the found in the mitochondria of a carrot cytoplasmic male genome that has previously been the site of naturally sterile (CMS) line, while a second segment had limited occurring insertions. Springer Tropical Plant Biol. (2008) 1:293-309 305 A Left border 3941 ATAAATAAAA CAATCCCTTC TGTCGTGTAT CCACGATTAA TGCAGCCTTA V 3991 GATGCTTCAA GANAAGIA,G Elacta.Mc ccggcaacaa ttaatagact Right border V 13761 acacttgagg ggccgactca cccggcgcgg cgttgacagMEE CCTCCGA 13811 AATACCAATA GACATGAAAG ATGATAGACA AAAAATGAAA CACTTTTCAA B Left border 309 GCTTTGATAG GTGCAATTGC TGTGGCTCGT CAGTAAGAAA TCTTTATAAT ptDNA GCTTTGATAG GTGCAATTGC TGTGGCTCGT CAGTAAGAAA TCTTTATAAT 359 TAG cgg cgataccgta aagcacgagg aagcggtcag cccattcgcc ptDNA TAGA Right border 609 gcgcgagccc ctgatgctct tcgtccagat catcctgatc ga ptDNA ,GAAG 659 GGTCICATAACI TTCTATTCNA GCAGTTTATG TACCTGCGGA TGANTTGACC ptDNA GGTCCATAAC TTCTATTCNA GCAGTTTATG TACCTGCGGA TGANTTGACC C Left border 6248 ATAGCCGGGG CATTGAGGAA TATCCAGAAA GGCATTTAGG GAATTGGTCT 6298 GAv 'm ,�q ` e atcgacg gcgagatcat tgggctgtcg Transformation sequence internal recombination border 7418 gtgagcgccg ccagtgagcc ttgcagctgc ccctgacgtt cctIcatIcc® 7468 isiytlag gcalaaclgcta gggccttgtt aggtcagttc cagctggggg Right border 7778 g9 9 g g iI 01J _ gcccatggag gcgttcgctg aac tt c a at �' aft; 7828 0i47 •TTTC CTTAGCCTAG GAATGCACTT TCTCCAGAAC CTGAAAGGTG Fig. 7 Papaya line 55-1 insert border junction sequences of the a shown in bold letters and palindromic sequences(arrows)found in the functional transgene insert,b nonfunctional nptll fragment insert,and left and right border junctions are shown in a.Plasmid-derived direct c nonfunctional tetA fragment insert. Junctions between transforma- repeat sequences in c are shaded gray. Microhomology between tion plasmid sequences (shown in small letters), and plant DNA plasmid insertion ends and possible preinsertion plastid DNA (pt derived sequences (shown in capital letters) or recombination DNA)-like ends b and between other plasmid insertion ends c are junctions between transformation sequences are marked by black shaded grey with white letters triangles. Topo I recognition sequences are boxed. Filler DNA is Availability of DNA sequences of the inserts from clones A major portion of this work on molecular analysis of and the WGS sequence of SunUp papaya, allowed analysis the transgene and transformation plasmid fragment inser- to assess the potential for expression of harmful or allergenic tion sites was generated during efforts to gain regulatory proteins and impact on endogenous genes.The potential for approval for the introduction of Rainbow and SunUp harmful or allergenic proteins deriving from the 55-1 papaya fruits to Japan markets. Although numerous data transgene was previously critically examined by others [22] addressing environmental and food safety issues were however, their conclusion that a single six amino acid submitted to the relevant Japanese regulatory agencies, peptide encoded by the PRSV CP transgene is potentially molecular analysis of the insertion sites was one of the key allergenic has since been refuted [52] and in the present data sets that were required for consideration [52]. study no harmful or allergenic proteins were detected even Presentation of the details of the insertion sites in Rainbow among novel ORFs spanning the insert junctions. In and SunUp in conjunction with the recent publication of the addition, available evidence suggests that no endogenous SunUp papaya genome [39] provides transparency and gene was disrupted in the creation of 55-1 line papaya. documentation as to the effect of transformation on the Springer 306 Tropical Plant Biol. (2008) 1:293-309 structure and function of the papaya genome, attesting to assembled into a single contig and manually edited or the safety of transformation technology. corrected where necessary. The tetA fragment insertion was obtained from 66B4, a clone of a BAC library of SunUp papaya DNA [38]. Sequence for the tetA fragment Methods insertion was obtained by primer walking. The nptll fragment insertion was identified from a contig derived Plant Material and Southern Analysis from four sequence reads of the WGS sequence of SunUp [39]. Papaya genomic DNA from various cultivars (see Table 1) was prepared from frozen,ground leaf tissue using a CTAB Determination of the Absence of aacC3 Fragment and chloroform-octanol based extraction protocol [45]. Sequences in 55-1 Genomic DNA was digested with eight unit endonuclease/ DNA at 37°C for 6-8 h per enzyme. 60 µg of digested The search for aacC3 related sequences in 55-1 including genomic DNA per lane was separated in 0.8% agarose, 1X screening of a 3X genome coverage Fosmid and l0X TBE and blotted to nylon membranes. Nonradioactive genome coverage BAC library prepared from SunUp DNA probes (Table 2) were synthesized from gel-purified PCR and various PCR approaches such as the Genome Walker templates using the DIG PCR labeling kit (Roche) and Kit (Clontech) and NlaII digestion coupled with polynu- resulting DIG-labeled products gel purified using QlAquick cleotide tailing [31]as well as thermal assymetric interlaced gel extraction kit(Qiagen). Hybridization was performed at (TAIL) PCR [32]. However, these methods failed to yield 42°C in Easy Hyb (Roche)with final washes in 0.2X SSC, data verifying the presence of aacC3-related sequences in 0.1% SDS at 55°C or 65°C.Detection was performed using DNA derived from 55-1 lines. anti-Digoxigenin-AP Fab fragments, DIG wash and block buffer set solutions, and CDP-Star ready-to-use substrate Insert Border Analysis according to the manufacturer's (Roche) instructions. Hybridization signals were captured using the Lumi-Imager Insert borders were identified by the Blast 2 Sequences Fl (Roche). Sites predicted to be the restriction ends of program [55] using the functional transgene, tetA frag- partial digest fragments for the functional transgene but not ment and nptll fragment insert sequences aligned to the nonfunctional tetA or nptll fragment inserts all pGA482GG (Gustavo, Fermin, unpublished sequence correspond to BglII-like sites indicating either that digestion data) and the cpPRV4 sequence [30]. Identity of flanking conditions caused star activity or that this locus is genomic DNA was obtained by a combination of blastn comprised of DNA with structural properties which inhibit analysis [1] as well blast2seq alignment of insertion site digestion at canonical sites and cause digestion at non- sequence to the papaya chloroplast genome (GenBank canonical sites. In any case, repeated attempts to eliminate Accession no. NC_010323.1). Insert junctions were the partial digest bands using over-digestion conditions scanned for Topo I sites by eye (see [46]) and flanking were unsuccessful. sequences examined for MAR sites using the EMBOSS Marscan program (http://emboss.sourceforge.net/). Filler Functional Transgene, and Nonfunctional tetA and nptll sequences at insert junctions flanked by nupts were Fragment Insertion DNA Sequence Determination identified by determining junction nucleotides that did not align to either papaya chloroplast nor transformation Sequence information for the PRSV coat protein trans- plasmid pGA482GG/cpPRV4 sequences by the Blast 2 gene insertion in 55-1 was obtained from a plasmid Sequences program. subclone (pRb6) obtained from a genomic DNA library generated from BglII endonuclease digested, Rainbow Analysis for Potential Expression of Allergenic or Toxic papaya genomic DNA enriched for DNA fragments over Proteins 10 kb and cloned into the A b1ueSTAR replacement vector from Novagen [6]. DNA from pRb6 clone was sheared ORF analysis was performed with the NCBI ORF finder using Hydroshear(Genomic Solutions)to 2 kb fragments, program at: http://www.ncbi.nlm.nih.gov/gorf/gorfhtml using end repaired and cloned in pUC 18 vectors. Insert frag- the regular codon usage function and 50 bp cutoff limit. ORF ments from these plasmids were sequenced from both ends analysis using the bacterial codon usage function yielded the using BigDye Terminator sequencing chemistry(BigDye® identical ORFs. Each ORF was searched against the nr(non- Terminator v3.1, Applied Biosystems) and analyzed with redundant)database by the NCBI Blastall program which runs ABI 3730x1 DNA Analyzers (Applied Biosystems). pRb6 Blastp in the command line [1]. Assessment of potential shotgun library sequenced clones (576 clones) were toxicity of proteins derived from ORFs was determined by Springer Tropical Plant Biol. (2008) 1:293-309 307 one of two methods set forth by the FAO/WHO allergenicity 7. Gonsalves D(1998)Control of papaya ringspot virus in papaya: rules presented in the Report of a Joint FAO/WHO Expert A case study. Annu Rev Phytopathol 36:415-437. doi:10.1146/ annurev.phyto.36.1.415 Consultation on Allergenicity of Foods Derived from Bio- 8. Gonsalves D, Ferreira S (2003) Transgenic papaya: A case for technology, 22-25 January 2001 [5], i.e. 35% homology to managing risks of Papaya ringspot virus in Hawaii. OnlinePlant allergenic proteins using a window of 80 amino acids identity Health Progress doi:10.1094/PHP-2003-1113-1003-RV between the query and an allergenic protein. 9. Gonsalves D, Gonsalves C, Ferreira S, Pitz K, Fitch M, et al (2004)Transgenic virus resistant papaya:From hope to reality for Each ORF amino acid sequence was also used to search controlling papaya ringspot virus in Hawaii.APSnet feature story for possible homology to allergens found at the University for July, 2004 Online at: http://www.apsnet.org/online/feature/ of Texas Medical Branch's Structural Database of Aller- ringspot genic Proteins (SDAP; http://fermi.utmb.edu/SDAP/sdap_ 10. Gonsalves D (2006) Transgenic papaya: Development, release, impact,and challenges.Adv Virus Res 67:317-354.doi:10.1016/ who.html). SDAP is a web server that provides database S0065-3527(06)67009-7 information and computational tools for the study of 11. Gonsalves D, Vegas A, Prasartsee V, Drew R, Suzuki JY et al allergenic proteins [20, 21]. The SDAP database contains (2006) Developing papaya to control Papaya ringspot virus by information on the allergen name, source, sequence, strut transgenic resistance, intergeneric hybridization, and tolerance breeding.In:Janick J(ed)Plant breeding reviews.John Wiley and titre, and IgE epitopes, if known. SDAP was developed Sons,Inc.,Hoboken,pp 35-73 using the allergens list from the JUTS(International Union of 12. Gonsalves D, Ferreira SA, Suzuki JY, Tripathi S (2008)Papaya. Immunological Societies) website, http://www.allergen.org, In:Kole C,Hall TC(eds)Tropical and subtropical fruits and nuts. supplemented with information from the literature and from Compendium of transgenic crop plants, vol. 5. Wiley-Blackwell, Oxford West Sussex Hoboken,pp 131-162 major sequence (SwissProt, PIR, and NCBI) and structure 13. Gonsalves D, Suzuki JY, Tripathi S, Ferreira SA (2008) Papaya (PDB) databases. The potential allergenicity of each ORF ringspot virus. In: Mahy BWJ, van Regenmortel MHV (eds) was reassessed regardless of whether or not they were Encyclopedia of virology.Elsevier Ltd,Oxford,pp 1-8 previously analysed by one or more of three methods using 14. Gorbunova V, Levy AA (1997) Non-homologous DNA end joining in plant cells is associated with deletions and filler DNA the database of allergenic proteins at the SDAP website: 1) insertions. Nucleic Acids Res 25:4650-4657. doi:10.1093/nar/ For ORFs > 60 a.a., a full fastA search for homologous 25.22.4650 SDAP database proteins as defined by an E value <.01 2) 15. Gorbunova V, Levy AA (1999) How plants make ends meet: Search to determine >35% similarity to SDAP database DNA double-strand break repair. Trends Plant Sci 4:263-269. doi:10.1016/S 1360-1385(99)01430-2 proteins over an 80 amino acid window 3) eight identical 16. Guo X, Ruan S, Hu W, Cai D, Fan L (2008) Chloroplast DNA amino acid search against SDAP database proteins. insertions into the nuclear genome of rice: the genes, sites and ages of insertion involved. Funct Integr Genomics 8:101-108. doi:10.1007/s 10142-007-0067-2 17. Heck GR,Armstrong CL,Astwood JD,Behr CF,Bookout JT et al References (2005)Development and characterization of a CP4 EPSPS-based glyphosate-tolerant corn event.Crop Sci 45:329-339 18. Huang CY, Ayliffe MA, Timmis JN(2004) Simple and complex 1. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zheng Z et al nuclear loci created by newly transferred chloroplast DNA in (1997) Gapped BLAST and PSI-BLAST: a new generation of tobacco. Proc Natl Acad Sci USA 101:9710-9715. doi:10.1073/ protein database search programs. Nucleic Acids Res 25:3389- pnas.0400853 1 0 1 3402. doi:10.1093/nar/25.17.3389 19. Huang CY, Granheit N, Ahmadinejad N, Timmis JN, Martin W 2. Brunaud V,Balzergue S,Dubreucq B,Aubourg S,Samson F et al (2005) Mutational decay and age of chloroplast and mitochon- (2002) T-DNA integration into the Arabidopsis genome depends drial genomes transferred recently to angiosperm nuclear on sequences of pre-insertion sites. EMBO Rep 3:1152-1157. chromosomes. Plant Physiol 138:1723-1733. doi:10.1104/ doi:10.1093/embo-reports/kvf237 pp.105.060327 3. Dai S, Zheng P, Marmey P, Zhang S, Tian W et al (2001) 20. Ivanciuc 0, Schein CH, Braun W (2002) Data mining of Comparative analysis of transgenic rice plants obtained by sequences and 3D structures of allergenic proteins.Bioinformatics Agrobacterium-mediated transformation and particle bombard- 18:1358-1364. doi:10.1093/bioinfonnatics/18.10.1358 ment. Mol Breed 7:25-33.doi:10.1023/A:1009687511633 21. Ivanciuc 0, Schein CH, Braun W (2003) SDAP: Database and 4. Drescher A,Ruf S,Calsa T Jr,Caner H,Bock R(2000)The two computational tools for allergenic proteins. Nucleic Acids Res largest chloroplast genome-encoded open reading frames of 31:359-362.doi:10.1093/nar/gkg010 higher plants are essential genes. Plant J 22:97-104. 22. Kleter GA, Peijnenburg AACM (2002) Screening of transgenic doi:10.1046/j.1365-313x.2000.00722.x proteins expressed in transgenic food crops for the presence of 5. FAO/WHO (2001) Evaluation of allergenicity of genetically short amino acid sequences identical to potential, IgE-binding modified foods. Report of a joint FAO/WHO expert consultation linear epitopes of allergens.BMC Struct Biol 2:1-11.doi:10.1186/ on allergenicity of foods derived from biotechnology.Available at: 1472-6807-2-8 http://www.who.int/foodsafety/publications/biotech/en/ 23. Knoop V,Unseld M,Marienfeld J,Brandt P,Sunkel S et al(1996) ec_jan2001.pdf. copia-, gypsy- and LINE-Like retrotransposon fragments in the 6. Fermin GA (2002)Use, application, and technology transfer of mitochondrial genome of Arabidopsis thaliana. Genetics native and synthetic genes to engineer single and multiple 142:579-585 transgenic viral resistance. Ph.D. Thesis, Cornell University, 24. Kohli A, Leech M, Vain P, Laurie DA, Christou P (1998) Geneva,p 293 Transgene organization in rice engineered through direct DNA 4)Springer 308 Tropical Plant Biol. (2008) 1:293-309 transfer supports a two-phase integration mechanism mediated by 44. Ruf S, Kossel H, Bock R (1997) Targeted inactivation of a the establishment of integration hot spots. Proc Natl Acad Sci tobacco intron-containing open reading frame reveals a novel USA 95:7203-7208.doi:10.1073/pnas.95.12.7203 chloroplast-encoded photosystem I-related gene. J Cell Biol 25. Kohli A,Twyman RM,Abranches R,Wegel E,Stoger E et al(2003) 139:95-102.doi:10.1083/jcb.139.1.95 Transgene integration,organization and interaction in plants. Plant 45. Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW Mol Biol 52:247-258.doi:10.1023/A:1023941407376 (1984) Ribosomal DNA spacer-length polymorphism in barley: 26. Kohli A, Christou P (2008) Stable transgenes bear fruit. Nat Mendelian inheritance, chromosomal location, and population Biotechnol 26:653-654.doi:10.1038/nbt0608-653 dynamics. Proc Natl Acad Sci USA 81:8014-8019. doi:10.1073/ 27. Kurtz S,Phillippy A, Delcher AL, Smoot M, Shumway M et al pnas.81.24.8014 (2004)Versatile and open software for comparing large genomes. 46. Sawasaki T, Takahashi M, Goshima N, Morikawa H (1998) Genome Biol 5:R12. doi:10.1186/gb-2004-1185-1182-R1112, Structures of transgene loci in transgenic Arabidopsis plants doi:10.1186/gb-2004-5-2-r12 obtained by particle bombardment: Junction regions can bind to 28. Liebich I,Bode J,Frisch M,Wingender D(2002)S/MARt DB:a nuclear matrices. Gene 218:27-35. doi:10.1016/S0378-1119(98) database on scaffold/matrix attached regions. Nucleic Acids Res 00388-6 30:372-374.doi:10.1093/nar/30.1.372 47. Shahmuradov IA,Akbarova YY,Solovyev VV,Aliyev JA(2003) 29. Liere K, Maliga P (2001) Plastid RNA polymerases in higher Abundance of plastid DNA insertions in nuclear genomes of rice plants. In: Anderson B, Aro EM (eds) Regulation of Photosyn- and Arabidopsis. Plant Mol Biol 52:923-934 thesis.Kluwer Academic Publishers,Dordrecht,pp 29-49 48. Somers DA,Makarevitch I(2004)Transgene integration in plants: 30. Ling K,Namba S,Gonsalves C,Slightom JL,Gonsalves D(1991) poking or patching holes in promiscuous genomes. Curr Opin Protection against detrimental effects of potyvirus infection in Biotechnol 15:126-131.doi:10.1016/j.copbio.2004.02.007 transgenic tobacco plants expressing the papaya ringspot virus 49. Souza MT Jr, Tennant PF, Gonsalves D (2005)Influence of coat coat protein gene.Bio/Technol 9:752-758 protein transgene copy number on resistance in transgenic line 63-1 31. Liu X,Baird V(2001)Rapid amplification of genome DNA ends against Papaya ringspot virus isolates.Hort Science 40:2083-2087 by NIaIII partial digestion and polynucleotide tailing. Plant Mol 50. Sugiura M (1992) The chloroplast genome. Plant Mol Biol Biol Rep 19:261-267.doi:10.1007BF02772898 18:149-168. doi:10.1007BF00015612 32. Liu YG, Mitsukawa N, Oosumi T, Whittier RF (1995) Efficient 51. Sugiura M,Hirose T,Sugita M(1998)Evolution and mechanism isolation and mapping of Arabidopsis thaliana T-DNA insert of translation in chloroplasts. Annu Rev Genet 32:437-459. junction by thermal assymetric interlaced PCR.Plant J 8:457-463. doi:10.1146/annurev.genet.32.1.437 doi:10.1046/j.1365-313X.1995.08030457.x 52. Suzuki JY, Tripathi S, Gonsalves D (2007) Virus-resistant 33. Lius S,Manshardt RM,Fitch MMM, Slightom JL, Sanford JC et transgenic papaya: Commercial development and regulatory and al (1997) Pathogen-derived resistance provides papaya with environmental issues. In: Punja SK, De Boer SH, Sanfacon H effective protection against papaya ringspot virus. Mol Breed (eds)Biotechnology and plant disease managment. CAB Interna- 3:161-168.doi:10.1023/A:1009614508659 tional,Wallingford,pp 436-461 34. Makarevitch I, Somers DA (2006) Association of Arabidopsis 53. Szabados L,Kovacs I,Oberschall A,Abraham E,Kerekes I et al topoisomerase IIA cleavage sites with functional genomic (2002) Distribution of 1,000 sequenced T-DNA tags in the elements and T-DNA loci. Plant J 48:697-709. doi:10.1111/ Arabidopsis genome. Plant J 32:233-242. doi:10.1046/j.1365- j.1365-313X.2006.02915.x 313X.2002.01417.x 35. Manshardt RM (1998) `UH Rainbow' papaya. University of 54. Takano M,Egawa H,Ikeda J,Wakasa K(1997)The structure of Hawaii College of Tropical Agriculture and Human Resources integration sites in transgenic rice. Plant J 11:353-361. New Plants for Hawaii-1,p2 doi:10.1046/j.1365-313X.1997.11030353.x 36. Martin W (2003) Gene transfer from organelles to the nucleus: 55. Tatusova TA,Madden TL(1999)Blast 2 sequences-a new tool Frequent and in big chunks.Proc Natl Acad Sci USA 100:8612- for comparing protein and nucleotide sequences.FEMS Microbiol 8614. doi:10.1073/pnas.1633606100 Lett 174:247-250.doi:10.1111/j.1574-6968.1999.tb13575.x 37. Matsuo M,Ito Y,Yamauchi R,Obokata J(2005)The rice nuclear 56. Tennant P,Fermin G,Fitch MM,Manshardt RM, Slightom JL et genome continuously integrates, shuffles, and eliminates the al(2001)Papaya ringspot virus resistance of transgenic Rainbow chloroplast genome to cause chloroplast-nuclear DNA flux.Plant and SunUp is affected by gene dosage, plant development, and Cell 17:665-675.doi:10.1105/tpc.104.027706 coat protein homology. Eur J Plant Pathol 107:645-653. 38. Ming R, Moore PH, Zee F, Abbey CA, Ma H et al (2001) doi:10.1023/A:1017936226557 Construction and characterization of a papaya BAC library as a 57. Tennant P,Souza MT Jr,Gonsalves D,Fitch MM,Manshardt RM foundation for molecular dissection of a tree-fruit genome. Theor et al (2005) Line 63-1: a new virus-resistant transgenic papaya. Appl Genet 102:892-899. doi:10.1007/s001220000448 HortScience 40:1196-1199 39. Ming R,Hou S,Feng Y,Yu Q,Dionne-Laporte A et al(2008)The 58. Tennant PF, Gonsalves C, Ling KS, Fitch M, Manshardt R et al draft genome of the transgenic tropical fruit tree papaya(Carica (1994)Differential protection against papaya ringspot virus isolates papaya Linnaeus).Nature 452:991-996.doi:10.1038/nature06856 in coat protein gene transgenic papaya and classically cross-protected 40. NASS (2007) Papaya acreage survey 2007 results. In: National papaya.Phytopathology 84:1359-1366.doi:10.1094/Phyto-84-1359 Agricultural Statistical Service,pp 1-8 59. Timmis JN, Ayliffe MA, Huang CY, Martin W (2004) 41. Pawlowski WP, Somers DA (1998) Transgenic DNA integrated Endosymbiotic gene transfer: organelle genomes forge into the oat genome is frequently interspersed by host DNA.Proc eukaryotic chromosomes. Nat Rev Genet 5:123-135. Natl Acad Sci USA 95:12106-12110 doi:10.1038/nrg1271 42. Purcifull D,Edwardson J, Hiebert E, Gonsalves D (1984)Papaya 60. Toyoshima Y, Onda Y, Shiina T, Nakahira Y (2005) Plastid ringspot virus.CMI/AAB Descriptions of plant viruses No 292(No transcription in higher plants. Crit Rev Plant Sci 24:59-81. 84 Revised,July 1984)8 pp CAB International,Wallingford,UK doi:10.1080/07352680590910438 43. Richly E, Leister D (2004)NUPTs in sequenced eukaryotes and 61. Tripathi S, Suzuki J, Gonsalves D (2006) Development of their genomic organization in relation to NUMTs.Mol Biol Evol genetically engineered resistant papaya for Papaya ringspot virus 21:1972-1980.doi:10.1093/molbev/msh210 in a timely manner-A comprehensive and successful approach. 'Springer Tropical Plant Biol. (2008) 1:293-309 309 In: Ronald P (ed) Plant-Pathogen interactions: Methods and 63. Vergunst AC, Hooykaas PJJ (1999) Recombination in the plant protocols. The Humana,New Jersey,pp 197-240 genome and its application in biotechnology. Crit Rev Plant Sci 62. Van Droogenbroeck B, Maertens I, Haegeman A, Kyndt T, 18:1-31. doi:10.1016/S0735-2689(99)00385-8 O'Brien C et al (2005) Maternal inheritance of cytoplasmic 64. Wilson AK,Latham JR,Steinbrecher RA(2006)Transformation- organelles in intergeneric hybrids of Carica papaya L. and induced mutations in transgenic plants: Analysis and biosafety Vasconcellea spp. (Caricaceae Dumort., Brassicales). Euphytica implications. In: Biotechnology and genetic engineering review. 143:161-168. doi:10.1007/s10681-005-3156-0 Lavoisier/Intercept,Cachan,pp 209-234 Springer O n w c-) r- 3%,•• -C --c —1;Z W "<-1 Genetically Engineered ___r- Plants and Foods: A Scientis s Analysis of the Issues (Part III) Peggy G. Lemaux Department of Plant and Microbial Biology,University of California,Berkeley, California 94720;email:lemauxpg @nature.berkeley.edu 3 0 3 3 ;' o cd 0 w 0 b "0 a a �w o� •\ Annu.Rev.Plant Biol.2009.60:511-59 Key Words The Annual Review of Plant Biology is online at benefits,biotechnology,crops,economics,environment,risks plant.annualreviews.org ri This article's doi: Abstract o 10.1146/annurev.arplant.043008.092013 Genetic engineering provides a means to introduce genes into plants Copyright©2009 by Annual Reviews. via mechanisms that are different in some respects from classical breed- cg-706 All rights reserved p ing. A number of commercialized, genetically engineered (GE)vari- g ° 1543-5008/09/0602-0511$20.00 eties, most notably canola, cotton, maize and soybean, were created using this technology, and at present the traits introduced are'herbi- cide and/or pest tolerance. In 2007 these GE crops were planted in 0 developed and developing countries on more than 280 million acres (113 million hectares)worldwide,representing nearly 10%of rainfed cropland.Although the United States leads the world in acres planted with GE crops,the majority of this planting is on large acreage farms. In developing countries, adopters are mostly small and resource-poor farmers.For farmers and many consumers worldwide,planting and eat- ing GE crops and products made from them are acceptable and even welcomed; for others GE crops raise food and environmental safety questions, as well as economic and social issues. In Part I of this re- view,some general and food issues related to GE crops and foods were discussed.In Part II,issues related to certain environmental and socio- economic aspects of GE crops and foods are addressed,with responses linked to the scientific literature. 5" Contents 1.INTRODUCTION 513 That Pose Environmental 2.ENVIRONMENTAL ISSUES.... 513 Risks?.'.:.............. . 528 2.1.Will the Widespread Use of Bt 2.14.What Happens When Pollen Crops Lead to the Development Moves From Genetically of Insect Resistance to Bt? 513 Engineered Crops to Wild 2.2.Can Genetically Engineered Relatives or Non-Genetically Crops Cause Adverse Effects Engineered Varieties?In Areas of on Nontarget Organisms? 516 Genetic Diversity? 529 2.3.Could the Use of Genetically 2.15.What Happens When Pollen Engineered Crops Result in a Moves from Genetically 0;o Loss of Plant Biodiversity? 517 Engineered Crops to Organic 3 2.4.Will the Use of Genetically Crops? 532 Engineered Crops Result in the 2.16.Can Organic,Conventional Population Decline of Other and Genetically Engineered 0 Organisms? 518 Cropping Systems Coexist? 533 0 2.5.Will the Use of 2.17.Can Use of Genetically 3 Herbicide-Tolerant Genetically Engineered Crops or Organic o c Engineered Crops Lead Farming Lead to More 40 2 to Superweeds? 519 Sustainable Agricultural 0 0" 2.6.What Methods Are Used to Production Systems? 534 c u, Help Plants Protect Themselves 3.SOCIOECONOMIC ISSUES 535 m o q M Against Pests? 520 3.1.Why Do Farmers Plant •g;,;; 2.7.Does the Use of Genetically Genetically Engineered Crops oEngineered Crops Result in and Who Profits From Them? .. 535 o M Decreased Use of Pesticides? 521 3.2.Will Plants with VD 0 2.8.Is It True that Bt Crops Need Terminator-Type Genes Prevent Cn o Additional Insecticide Replanting of Genetically o N Applications? 524 Engineered Crops? 537 a 2.9.Can the Introduction of Virus- 3.3.Why Are Genetically a Resistant Genetically Engineered Engineered Crops Patented? Plants Lead to Novel Viruses?... 525 Does This Affect Farmers in the x 2.10.Can Plants and Microbes United States or Developing Be Engineered To Improve Countries? 538 the Environment) 526 3.4.Does the Export Market Affect 2.11.Can Genes From Genetically Decisions by Farmers to Grow Engineered Plants Move to Genetically Engineered Crops? 539 Bacteria in the Field? 527 3.5.Who Is Commercializing 2.12.Is the Loss of Honeybees Due Genetically Engineered Crops to Genetically Engineered and What Is the Outcome? 541 Crops? 527 3.6.Don't We Produce Enough 2.13.Can Federal Regulatory Food to Feed the World Without Agencies Stop Planting of Genetically Engineered Genetically Engineered Crops Crops? 542 4.CONCLUDING REMARKS 543 512 Lelnaux , r 1.INTRODUCTION genetic change,the impact on the genotype and Genetically engineered (GE) crops and foods phenotype of the crop, and the consequences have been commercially available in the United for the environment.Regarding these issues,it GE genetically was recently suggested that certain analyses are engineered States since 1995 and their adoption around g the world followed,showing increases each year too crude to allow meaningful assessments of Recombinant DNA since their introduction(Table 1).Whereas the environmental consequences and require geo (rDNA): DNA that is majority of the acreage is in the United States, graphical data to be collected on a smaller,more manipulated most farmers who grow these crops reside out- defined basis(197). enzymatically in the side the United States—more than 10 million of laboratory using recombinant DNA the 12 million adopters are in developing coun- 2.1.Will the Widespread Use of Bt technologies tries(165).These GE crops created by recom- Crops Lead to the Development Peer-reviewed: A binant DNA (rDNA) have been overwhelm- of Insect Resistance to Bt? publication that has ou ingly accepted by farmers,but some consumers been reviewed,usually ° remain skeptical.In Part I of this review(186a), Bacillus thuringiensis(Bt),a widespread soil bac anonymously,and general descriptions of the process of genetic terium,produces insecticidal proteins called Bt approved by other toxins(12 7).There are many Bt strains that pro- experts in the author's engineering,its implications,and its regulation field before it is o were discussed, as well as responses to several duce characteristic sets of toxins, each with its g P own activity spectrum that targets larvae of spe- published o food and food safety issues.In Part II certain en- Marker assisted cific insect species. For example, some Bt tox- 3 vironmental and socioeconomic issues are dis- selection: process by o a cussed.Not all issues that have been raised are ins kill larvae of particular species of moths and which breeders use a `' 2 discussed and not all aspects of the issues re- butterflies; others kill larvae of certain species marker v 4 of beetles or mosquitoes. Bt sprays have been (morphological, viewed are addressed, but the present state of 0 0 used to control insects since the 1920s(127),but biochemical,DNA,or c w knowledge is reviewed. RNA variation)for g''' As scientifically accurate a picture as possi- use of specific Bt toxins has increased dramat indirect selection of a C.N ically since 1996 with the introduction of GE Cr, ble was presented by linking responses to peer- genetic determinant "'° reviewed literature.This approach does not im crops. for a trait of interest r en ply that people possessing the same scientific Bt toxins are also called Cry toxins because Phenotype: `'0 information will come to the same conclusions they exist as crystals inside the bacterium.Full- observable physical or cD about GE crops and their products.Individual length Cry toxins are inactive until cleaved to biochemical o�oO value judgments vary and thus different conclu- generate their active form in the insect midget characteristic of an w-' (236, 261). Binding of activated forms of Cry organism dictated by a lions are reached.Asa scientist,I feel,however, genetic makeup or 1 that what science has discovered about these toxins to receptors in the midget is generally environmental effects a believed to be essential for toxicity.According crops should be a part of what individuals con- Bt: Bacillus sider in making decisions about growing and to one model(168,277),after binding midget thuringiensis 0 consuming these crops. receptors,activated toxins form oligomers that Cry: crystal protein create pores in midgut membranes, causing contents to leak, ultimately killing the larvae. Toxicity: adverse physiological effects The precision of Bt proteins for certain insects following exposure to 2.ENVIRONMENTAL ISSUES and their lack of effects in mammals are due to a substance When contemplating environmental impacts of the specificity of receptor binding(107). GE crops, it is important to consider that the As of July 2008, deregulation has been ap- fundamental issues raised are similar in many proved in the United States for thirteen dif- ways to those encountered with crops created ferent Bt events of corn (Zea mays), five of by other genetic modification methods,such as cotton (Gossypium hirsutum), five of potato mutation or marker assisted selection,and culti- (Solanum tuberosum), and one of tomato (Ly- vated in other ways,such as the use of integrated copersicum esculentum) that produce one or pest management and organic and biocontrol more Cry proteins: CrylAb, CrylAc, Cry1F, methods.The issues include the nature of the CrylAb,Cry3A,Cry3Bb1,Cry9C,Cry34Ab1, www.annualreviews.org • Genetically Engineered Plants and Foods 513 � t and Cry35Ab1 (159).Bt potato and tomato are thereby making resistance functionally reces- not grown commercially in the United States at sive(286). Hectare: a metric present.Bt corn producing CrylAb and Bt cot- In the United States and some other unit used for area ton producing CrylAc account for the majority countries,refuges of non-Bt crops are required measurement of the 494 million acres(200 million hectares) (103).A 2005 survey showed that U.S.farmers (especially in (hectare = ha = 2.47 acres)of Bt crops grown believe refuges are effective in managing resis- agriculture)that is worldwide during the ten-year period from tance(6); 91% of farmers were found to meet equivalent to 1996 to 2007 (164). These two Bt crops kill the regulatory requirements for refuges asso- approximately 2.471 acres or 107,639 some key lepidopteran pests, including Euro- ciated with Bt corn(218).A study of Bt cotton square feet pean corn borer (Ostrinia nubilalis) on maize revealed compliance with the refuge strategy APHIS: Animal and and pink and cotton bollworm (Pectinophora was higher than 88% in five of six years from Plant Health gossypiella and Helicoverpa armigera)and tobacco 1998 to 2003 (63). In addition to mandating Inspection Service budworm (Heliothis virescens) on cotton. As of non-Bt crop refuges, the U.S. Environmental o USDA: United States July 2008,applications have been filed with the Protection Agency(EPA) requires monitoring 3 Department of Animal and Plant Health Inspection Service for field resistance to provide early warning Agriculture (APHIS)of the U.S.Department of Agriculture of resistance development (103). In Arizona, EPA: Environmental (USDA) to conduct 844 small-scale, precom- where Bt cotton producing CrylAc has been gProtection Agency mercial field tests of 30 different plant species used widely since 1997 and pink bollworm has 3 ° Pyramid(stacking) engineered with Bt genes[e.g.,apple,cranberry, been under intense selection for resistance, a strategy: deployment grape,peanut,poplar,rice,soybean,sunflower, a statewide surveillance system for resistance o0 of varieties expressing and walnut(158)],although the actual number exists.From 1997 to 2004,results of laboratory different genes by a) a incorporating both of tests conducted is not known. bioassays of insects derived annually from 10 c ° genes in a single Evolution of insect resistance to Bt toxins to 17 cotton fields statewide showed no net 33 variety,as with two can reduce the long-term effectiveness of Bt increase in mean frequency of pink bollworm different Bt genes crops (136, 282, 286, 290). Strains of many resistance to Bt toxin (284). DNA screening pests have been selected for resistance to Bt tox- from 2001 to 2005 also showed that resistance- - 8 ins in the laboratory,and two lepidopteran in- linked mutations remained rare in pink M sects,Plutella xylostella and Trichoplusia ni,have bollworm field populations(285).Sustained ef- oevolved resistance to Bt sprays in the field and in ficacy of Bt cotton has contributed to long-term •N greenhouses, respectively(166, 284).The pri- regional suppression of pink bollworm(64). mary strategy in the field for delaying insect re- Although the strategies implemented to de- sistance to Bt crops is planting refuges of non-Bt lay resistance have helped sustain efficacy of ° crops near Bt crops(103, 136,286).This strat- Bt crops longer than many scientists expected, egy is based on the idea that insects feeding on field-evolved resistance to Bt crops was re- plants in the refuge are not selected for resis- ported recently (200, 286, 312). Analysis of tance,because those plants do not make Bt tox- published monitoring data from the United ins.Under ideal conditions,insect resistance to States, Australia, China, and Spain for major Bt toxins is recessive.Thus, heterozygous off- lepidopteran pests targeted by Bt crops indi- spring,produced when homozgygous resistant cated field-evolved resistance in Helicoverpa zea, insects mate with susceptible insects,are killed but not in pink bollworm or the four other in- by the Bt crop. Models predict that resistance sects examined (Helicoverpa armigera, Heliothis can be postponed substantially if the rare ho- virescens, Ostrinia nubilalis,and Sesamia nonagri- mozygous resistant insects surviving on a Bt oides). Evaluation of the large data sets of two crop mate with the more abundant susceptible landmark studies (7, 192) revealed that resis- insects from refuges (136, 282). The strategy tance to CrylAc produced by Bt cotton oc- is called the high-dose/refuge strategy because curred in 2003 to 2004 in some field populations the created plants produce Bt toxin concentra- of H.zea in Arkansas and Mississippi,but not in tions high enough to kill heterozygous insects, H.virescens from the same region.Resistance of 514 Lemaux H.zea to CrylAc has not resulted in widespread Other approaches to delaying resistance de- crop failures,in part because existing insecticide velopment have been suggested. The efficacy sprays and other tactics are still effective against of mixing seeds of Bt and non-Bt varieties of this pest(286).Correspondence between mon- the same crop has been debated(193);to date, itoring data and results from computer mod- evidence to resolve this issue has been limited eling of resistance evolution suggests that the to theoretical models and small-scale experi- principles of the refuge strategy for these pests ments (148, 187, 193, 267, 283). The practi- and Bt crops are relevant in the field.Also con- cal advantage of seed mixtures in ensuring that sistent with monitoring data,modeling suggests non-Bt plants grow near Bt plants may out- H.zea would evolve resistance faster than other weigh possible advantages of spatially separate pests,because its resistance to CrylAc is domi- refuges(65).Another suggestion to shorten pe- nant,not recessive as with other Bt toxins(286). riods of insect exposure and slow evolution of Monitoring data also suggest relatively large insect resistance is the use of inducible promot- o refuges may have delayed H. zea resistance to ers to drive Bt gene expression only during in- CrylAc in North Carolina (286). Field resis- sect attack(31).Another approach uses knowl- • tance of Busseola fusca was reported in 2007 to edge of insect resistance mechanisms to design • CrylAb and CrylF in maize in South Africa modified toxins to kill resistant insects (277), g (312),and in 2008 field resistance of Spodoptera on the basis of the fact that the most corn- • frugiperda was reported in Puerto Rico mon mechanism of Cry IA resistance in lepi- 3 (200). dopteran insects involves disruption of Bt toxin First-generation GE crops produced only binding to midgut receptors(111).Mutations in b = one Bt toxin in each plant. A second ap- midgut cadherins that bind CrylAc are linked • o proach designed to delay resistance is called the with and probably cause resistance to CrylA 2w • pyramid or stacking strategy and entails corn- toxins in at least three lepidopteran pests of •\ bining two or more toxins in a single plant, cotton (121, 209, 333). The role of cadherin o each with different modes of action (254). If in Bt toxicity was elucidated by silencing the no cross-resistance exists between the two tox- cadherin gene in Manduca sexta,which reduced M ins, frequency of insect resistance to both tox- its susceptibility to CrylAb (277). Consistent CD ins is much lower than that for one toxin. Im- with the role of cadherin in promoting toxin ` Q6 portantly, tests of this approach with a model oligomerization demonstrated by removing an o system using GE broccoli and the insect pest a-helix from CrylA toxins,toxin-binding frag- • n Plutella xylostella suggested that concurrent use ments of cadherin were required for oligomer of plants with one and two toxins selects for re- formation of native Cry lA toxins, but not for a sistance to two-toxin plants more rapidly than CrylA toxins lacking the a-helix.The modified the use of two-toxin plants alone(338). In the CrylA toxins killed cadherin-silenced M.sexta United States, Bollgard II® cotton producing and CrylA-resistant pink bollworm larvae,sug- CrylAc and CrylAb was introduced commer- gesting that modified Bt toxins might be effec- cially in 2003 and has been grown alongside tive against insects resistant to native Bt toxins Bollgard cotton producing only CrylAc. On (277). the basis of the results with the model broccoli In summary,just as insects have evolved re- system(337), this concurrent use of one-toxin sistance to synthetic insecticides and Bt tox- and two-toxin Bt cotton may not optimize the ins in sprays,they are evolving resistance to Bt benefits of the two-toxin cotton. In contrast, toxins in GE crops. The elapsed time before Australian cotton growers stopped planting cot- the first cases of field resistance of insects to ton that produces only CrylAc soon after two- Bt crops were reported has been longer than toxin Bt cotton became available;this strategy what was predicted under worst-case scenar- might result in delayed resistance development ios,suggesting that management strategies may (337). have delayed resistance development. Despite www.annualreviews.org • Genetically Engineered Plants and Foods 5t5 documented cases of resistance,Bt crops remain and weight gain in fields of 176,however,were useful against most target pests in most regions. much greater than in fields sprayed with the RNA As insect resistance to Cry toxins currently de- insecticide Warrior 1E (279). The EPA con- interference ployed in Bt crops increases, other strategies cluded from these studies that Bt corn was not Pesticide: any to create GE crops resistant to insects are be- a significant factor in field death of monarch lar- naturally occurring or ing developed,including vegetative insecticidal vae, particularly relative to factors such as the synthetically produced proteins (Vips) from Bt(190) and RNA inter- widespread use of pesticides and destruction of substance or mixture ference(RNAi)(32, 195). the butterfly's winter habitats(207,237). of substances used to To "encourage evidence-based risk analy- prevent,destroy,repel, sis,"Marvier et al. (198)published a report in or mitigate any pest, 2.2. Can Genetically Engineered 2007 describing a searchable database on the ef- which includes insects, Crops Cause Adverse Effects g weeds,fungi,bacteria, fects of Bt on nontarget insects(217).In a meta- viruses,or mice and on Nontarget Organisms? analysis of 42 field experiments,taking into ac- v other animals Various published studies analyzed effects of Bt count location,duration,plot sizes,and sample maize on nontarget insects. Two well-known sizes,these authors concluded that(a)the mean studies focused on monarch butterflies (191) abundance of all nontarget invertebrate groups, and on black swallowtails(329).The first,a note in terms of numbers,survival,and growth,was Eto Nature in 1999, was a laboratory study in greater in Bt cotton and Bt maize fields than 3 u which monarch caterpillars were fed milkweed in non-Bt fields managed with insecticides but, leaves dusted with loosely quantified amounts (b) if Bt crop fields and insecticide-free fields o of pollen from a single Bt corn variety. In the were compared,certain nontarget insects were R second study in 2000, black swallowtail cater- less abundant in Bt fields. Cpillars were placed different distances from a Effects of Bt on the biodiversity of nontar- o cornfield planted with a Bt corn variety differ- get soil microorganisms were studied follow- ent from that used in the 1999 study; popula- ing four years of cultivation of four maize va- c,‘ •o tions were studied for effects of Bt for seven rieties with two different Bt proteins (CrylAb Mdays.In the first study more monarch caterpil- and Cry3Bbl)versus near isogenic non-Bt va- "' lars died when they ate leaves dusted with Bt rieties(154).In general,although numbers and corn pollen versus leaves dusted with conven- types of microbes and enzyme activities differed N tional corn pollen.In the second study,no nega- from season to season and among varieties,no tive effects of Bt pollen were found on numbers statistically significant differences were seen in of swallowtail caterpillars. numbers of different microbes, enzyme activi- a After those papers appeared,data from nu- ties, or pH between soils with Bt and non-Bt C4' merous university studies performed in the lab- corn. In similar studies comparing impacts on coratory and in the field on the effects of Bt the rhizosphere of Bt cotton versus non-Bt cot- corn on monarch butterflies were published(62; ton,various enzymatic activities were measured for a summary of studies see References 102 before and after harvest(268).The authors con- and 264). After reviewing the data, the U.S. chided that richness of the microbial commu- EPA concluded there was a very low probabil- nities in the rhizosphere did not differ between ity of risk to monarch butterflies beyond 12 feet Bt and non-Bt cotton.No CrylAb protein was from the Bt corn field.Two varieties,Btl 1 and detected in the rhizosphere soil of field-grown Mon810,had no acute adverse effects, even at Bt rice(316). pollen densities greater than the highest densi- Effects on foliage-dwelling arthropods of Bt ties observed in cornfields(239).Another vari- maize expressing Cry3Bbl to protect against ety, 176,had limited negative impacts on some corn rootworm(Diabrotica sp.)were compared nontarget insects because expression of the 3' with those of conventional insecticide treat- truncated crylAb was linked to a maize pollen- ments (43). Bt maize had no consistent ad- specific promoter (2). Rates of larval survival verse impacts on abundance of any nontarget fr6 Lemaux arthropods;however,insecticide treatments ap- 2.3. Could the Use of Genetically plied to the plant foliage significantly and con- Engineered Crops Result in a Loss sistently decreased abundance of three non- of Plant Biodiversity? Transgene: gene that target insects: ladybird beetles,lacewings, and Food crops were first domesticated from wild is manipulated using damsel bugs. Thus, reducing foliar sprays species approximately 10,000 years ago when recombinant DNA with the use of Bt corn has the potential to nomadic hunter-gatherers shifted to an agrar- technologies and enhance approaches using biological control reintroduced into a ian lifestyle (287). Through human involve- host organism,where agents. ment in plant selection a profound effect was ex- the DNA becomes part Another potential effect of Bt crops on erted on the genetic landscape,as plant species of the host's genetic nontarget organisms is the passage of Bt from with favorable mutations were selected for makeup and is passed fields to nearby aquatic environments with propagation. Biodiversity in agroecosystems, to the next generation the possibility of increasing horizontal gene which reflects not only species richness,but also Genetic erosion: loss flow to microbes and mortality of nontarget the diversity of their interactions (214), con- of genetic diversity o stream insects.To test this potential effect,soil, ti between and within timed to decline with changes in agricultural populations of the sediment, and water samples were analyzed practices and plant breeding efforts, both of same species over time after spiking sediments and surface waters with which focused on providing the high yields de- or reduction in the 0• Bacillus thuringiensis kurstaki and genomic DNA manded by expanding populations(8,101 274). genetic bases of a g from GE Bt corn(89). PCR analyses revealed species due to human o These negative effects on biodiversity, some- 3 a) that half-lives for both sources of Bt DNA were intervention, 3 times termed genetic erosion(116),also led to environmental o 1.7 d for clay-and sand-rich sediments and 14.3 loss of weed species,killing of nontarget pests, changes,and other �: o d in surface water. Soil, sediment, and surface and destruction of natural habitats for insects factors 70 s-4 P. water from Bt maize fields were also tested for and wild animals(204).The larger the agricul- Germplasm: A 0 w the presence of crylAb two weeks after pollen rural acreage, the greater the impact on sur- collection of genetic 3 M release,after corn harvest,and after mechanical rounding flora and fauna. CS,� resources of an •\ root remixing. Sediments had more cry organism,sometimes Frankel (116) established principles of ge stored as a seed DNA than surface water, perhaps reflecting netic erosion that describe agriculture's impact collection binding to soil particles that increased its on biodiversity: (a)during premodern agricul- 6 M persistence; however, CrylAb protein was Group o Consultative o° undetectable in most samples.Without making ture, in centers of diversity, crop species were Group on N p stable; (b)introduction of modern agricultural International o N field measurements on nontarget populations, technologies,including new varieties,led to in- Agricultural Research w it was suggested that release of products with stability;(c)competition between local and in- 'a'A Bt transgenes into the environment might troduced varieties led to displacement of Io- la.. adversely affect nontarget organisms;however, ,>,' cal varieties; and (d) displacing local varieties rx other researchers objected because actual eroded genetic variability of regional crop pop- C measurements were not made(35,232). ulations.Plant breeding in the early 1960s pro- ¢ Although many studies focus on potential duced high-yield varieties of major food crops, negative effects of Bt on nontarget organisms, resulting in yield increases but also significant potential benefits to nontarget insects have also displacement of traditional varieties and a con- been noted. Bt maize is more susceptible to comitant loss in genetic diversity, particularly corn leaf aphids(Rhopalosiphyum maidis),which landraces of cereals and legumes(100). leads to larger colony densities and increased Recognition of this consequence on ge- production of the honeydew consumed by ben- netic diversity led to the development of global eficials such as a parasitoid of aphids, Cot genebanks and collections to conserve ge- marginiventris (106). This observation under- netic resources, such as those maintained by scores the delicate balance in nature between the USDA's National Plant Germplasm Sys beneficial and detrimental side effects of insect tern and the Consultative Group on Interna- protection strategies. tional Agricultural Research (CGIAR). These www.annualreviews.org • Genetically Engineered Plants and Foods 5.17 e p collections, which preserve precious landraces (IP)issues(Section 3.3).Thus it is difficult for and wild relatives,are the foundation of future these companies to move traits into local vari- Classical breeding: classical breeding, marker assisted selection, eties,which leaves the task to larger companies. deliberate crossing of and genetic engineering efforts and it is critical However,regulatory costs,IP,and other issues compatible individuals to maintain and enlarge these resources.Molec- likely limit the numbers of varieties into which to introduce ular and genomic technologies enable identifi- GE traits are moved by these companies, po- traits/genes from one cation of genetic variants and development of tentially narrowing the genetic base available organism into a new detailed genetic descriptions of diversity,lead- to farmers. genetic background ing to greater appreciation of these resources. Gene flow: transfer Information technology, which enables analy- of genetic information 2.4.'Will the Use of Genetically individuals or sis of large data sets,has also led to advances in y populations;can occur conservation and use of plant genetic resources. Engineered Crops Result in plants when pollen The commercialization of herbicide- in the Population Decline w moves from one of Other Organisms? o tolerant (HT) and insect-tolerant (Bt) GE compatible plant to crops raised questions about the environmental The diversity and numbers of other organisms another and genetic conservation impacts of gene flow known to play important roles in controlling aHT: herbicide from GE crops to wild and weedy relatives. pests and diseases(e.g.,microorganisms,preda- o tolerant This gene flow could lead to selective ad- tors, birds, parasitic wasps) could be affected • 0 IP: intellectual vantages (e.g., enhanced invasiveness and/or by the presence of GE crops. On the basis of 3' property weediness) of recipients in certain environ- mathematical modeling predictions,the diver- 0 0 DEFRA: Department w o ments(145); this phenomenon is of particular sity of such organisms might be at risk because b for Environment Food o. and Rural Affairs interest in centers of crop diversity. Careful of HT crops(319).Assuming fewer weeds grow o• o measures are needed when cultivating GE in HT crop fields versus conventionally sprayed o crops near such centers (100); however, this fields,smaller numbers of weeds might lead to •\ situation is not unique to GE plants and can less food for grain-eating birds and to possible and does happen with conventionally bred, declines in bird populations, a potential prob- commercialized crops(97).Key to judging the lem with large-scale deployment of HT crops. V impact of transgene movement is the nature of Conversely,because herbicides are usually ap- o the trait and the frequency of its introduction plied later with HT crops, there are possible into an ecosystem. Studies of the impact of advantages for birds that breed in such fields o transgenes moving into wild relatives and the (99), because dead weed material left behind potential to change ecosystem dynamics are can serve as nesting grounds (112). This po- currently requested in environmental impact tential consequence of HT crops may not be as rx statements written for commercial release significant in North America,where vast areas of a new GE plant (10). Although such tests of unfarmed land remain for birds and animals are limited in scope and do not address all to find weeds and seeds. In Europe, however, eventualities, they do provide insights into where land is more restrictive,the impact of HT possible outcomes.Just as with other agricul- crops might be more pronounced, leading to tural practices,certain impacts of GE crops on use of buffer strips to enhance feed and nesting the environment need to be monitored, even habitats. after deregulation(Section 2.1). To quantify effects of HT crops in the Another consideration regarding effects of United Kingdom on bird and animal popu- GE crops on diversity of local, adapted crop lations, the impact of four HT crops (sugar varieties is that most current, commercial GE beet, maize, and spring and fall oilseed rape) varieties were developed by large,mostly inter- on abundance and diversity of farmland wildlife national companies. The few small seed corn- was compared with that of conventional vari- panies remaining(110)have no legal access to eties. This effort was initiated in 1999 when GE traits, due in part to intellectual property the Department for Environment, Food, and p8 Lensaux Rural Affairs(DEFRA)commissioned an inde- rate this situation in conventional,organic,and pendent consortium of researchers to conduct GE cropping systems(122, 141). a five-year study involving 266 field trials(87). Resistant weeds have arisen associated with Outcrossing: process Results of the study were not uniform for all an herbicide used with a GE HT crop, i.e., by which plants crops.For sugar beet and spring rape,conven- glyphosate or Roundup® (216). Among the reproduce by tional varieties harbored more insects because species worldwide with documented resistance dispersing their pollen of the presence of weeds and weed seeds.Grow- are ryegrass(Lolium perenne)in Australia(240), to other compatible ing HT maize led to more weeds and seeds be- goosegrass(Eleusine indica)in Malaysia(185),li- Plants,rather than self-pollinating cause of late timing of herbicide application and verseed grass(Urochloa panicoides)in New South thus resulted in more butterflies and bees.HT Wales (242), and in the United States horse- Hybridization: crossbreeding plants of and conventional winter rape were comparable weed (Conyza canadensis) in Delaware (311), different varieties, in numbers of weeds,but in HT rape there were California (272), Indiana, and Ohio (243) and species,or genera to fewer beneficial weeds,resulting in fewer bees pigweed(Amaranthus palmeri)in Georgia(82). create a plant with o and butterflies. Negative effects of HT weed Overuse of single herbicides can lead to this sit- traits from each parent control strategies on sugar beet can be counter- uation and will reduce the effectiveness of the AFLP: amplified acted by leaving two rows per 100 untouched, GE HT crop.Having HT cultivars with resis- length resulting in weed seed production equal to that tance genes for herbicides with alternate modes polymorphism in non-HT crops(234).Researchers concluded of action that can be used in rotation will slow GURT: genetic use 8 3 ° that differences among crops were not caused resistance development in weeds. Use of Lib- ;' restriction technology by plants'being GE,but instead were the result erty Link®varieties,which are tolerant to glu- E ti of HT varieties giving farmers new weed con- fosinate(33),and development of GE dicamba btrol options with differing impacts.In thinking resistance strategies(38)are steps in that direc- about options,farmers should consider sizes of tion(Section 2.6). o acreages planted,proximity to other crops,and HT weeds can also arise because of out- •\ crop rotations. crossing with HT GE crops. The frequency o of occurrence depends on many factors, par- - a ticularly the existence of compatible weedy M2.5.Will the Use of species.In the United States some commercial- Herbicide-Tolerant Genetically ized GE crops do not have native wild weedy Engineered Crops Lead CO relatives (142), but some do. Canola, in par- 0 CV to Superweeds? ticular, can naturally form crop-wild hybrids The concept of a superweed conjures up the and, even though fertility is often reduced, image of a weed taking over entire ecosystems, fertile offspring can be recovered (203, 318). undeterred by existing herbicides. Although For example, in Quebec, Canada, hybridiza- this scenario is not based in fact,problems with tion between transgenic canola (Brassica na- herbicide-resistant weeds are real,but not new pus) and neighboring weedy Brassica rapa was These problems have occurred with tradition- documented (318). Although hybrid lineages ally bred crops,as well as with HT GE plants. declined dramatically over time, B. napus am- Historically herbicide resistance arose because plified fragment length polymorphism(AFLP) of herbicide overuse or movement of con- markers persisted in B. rapa, likely because of ventional herbicide-tolerance traits to weedy the presence of the HT transgene in diploid species,resulting in plants not controllable with B. rapa, which, despite reduced pollen fertil- previously applied herbicides (58, 163, 281). ity, still produced offspring with high pollen Although this phenomenon does not lead to fertility.More notably, the HT transgene per- so-called "environmental disasters,"it reduces sisted in the B. rapa population without her- the effectiveness of certain weed control strate- bicide applications from 2003 to 2008 (317). gies and decreases weed management options. Also, a triple-resistant canola plant(146)with Good weed management practices can amelio- two GE traits and one mutation-induced HT www.annualreviews.org • Genetically Engineered Plants and Foods 519 trait was found in Canada in 2000.HT B.rapa tween commercial rice and red rice(both Oryza and the multiply resistant canola are control- sativa);the latter is the most troublesome weedy EPSPS: 5-enol- lable with other herbicides, but weed control species in many rice-growing regions of the pyruvylshikimate-3- options are reduced.Also,with triple-resistant world(323). phosphate canola, the likelihood for mixing GE canola Crop tolerance to herbicides is achieved synthase with non-GE canola targeted for a GE-sensitive (a) by mutations that render a plant not PAT: market is increased, possibly resulting in eco- susceptible to the herbicide or(b)through the Phosphinothricin-N- nomic losses(Section 3.4).One approach to re- introduction of transgenes.An example of the acetyltransferase ducing transgene movement is use of genetic first approach was the identification of varieties use restriction technologies(GURTs)(Section that,after treatment with a chemical mutagen, 3.2), which prevents gene passage to the next were tolerant to imidazolinone herbicides; generation. these Clearfield® varieties (80) are tolerant to Overuse of herbicides can also result in weed herbicides, such as Pursuit® and Raptor®. In o shift,where weeds naturally resistant to an her- the second approach to be commercialized,GE bicide encroach upon areas where the herbi- crops, tolerant to glyphosate or Roundup®, cide is in use.In 2006,no Roundup®-resistant were engineered with a bacterial gene encoding weed shifts had occurred with HT maize, but a target enzyme, 5-enol-pyruvylshikimate-3- some had occurred with HT cotton(Gossypium phosphate synthase (EPSPS), which confers 3 ° hirsutum) and soybean (Glycine max), in some tolerance to the herbicide (30). More re- 3 cases leading to economic concerns (81). Ap- cently, other commercialized HT GE crops 24 o proaches to mitigate this situation include use were created with tolerance to glufosinate or bof other herbicides with Roundup®,rotation to Liberty®by introducing phosphinothricin-N- aw non-Roundup®herbicides,and/or use of non- acetyltransferase (pat) or bialaphos resistance o Roundup Ready® crops. Development of ei- (bar) genes from Streptomyces sp. that encode ther herbicide-resistant weeds or weed shifts enzymes that detoxify the herbicide's active t o with HT crops might negate the positive en- ingredient(324). The leading commercialized Mvironmental benefits of HT crops.Weeds can insect-tolerant GE crops have genes from M also escape herbicide treatment on the basis of the soil bacterium Bacillus thuringiensis, which application rate,weed age and size, spray vol- encode pesticidal Cry proteins that protect the ume,adjuvants used,water quality,and interac- plant against specific insect pests(Section 2.1). Ttions with other herbicides that affect efficacy The first GE HT crops, cotton, corn, and (263). Weed escapes also occur because some soybean,have been grown commercially in the weeds germinate late, after the last herbicide United States since 1995 (3). In 1996 HT application (147), and thus are not controlled soybean comprised 7% of total U.S. soybean by Roundup®. acreage,compared with 92%in 2008(Table 1; 299a). HT soybeans and cotton are the most widely and rapidly adopted GE crops in the 2.6.What Methods Are Used to Help United States, followed by insect-resistant Bt Plants Protect Themselves cotton and corn,which were also approved for Against Pests? commercial production in 1995. In 1996, Bt Pesticides, used to control plant pests, are cotton was estimated to compose 15% of U.S. needed because plants cannot move to avoid cotton acreage or 1.8 million acres (0.73 mil- pests.Although useful in some cases,pesticides lion hectares) (299), and Bt corn was grown (i.e.,herbicides,insecticides,and fungicides)are on approximately 1% of the U.S.corn acreage costly to the farmer and can be damaging to (Table 1;61,109).Since 1996,both Bt corn and the environment and to humans. Herbicides cotton crops have been widely adopted,and,as must distinguish between desirable crop plants individual traits,represent 17% (298)and 18% and undesirable weedy species,for example be- (299), respectively, of cultivated U.S. acreage 520 Lemaux . , in 2008.However,these percentages represent Table 1 Percent of total acreage of genetically engineered crops in the varieties with individual traits and account for United States' only part of the adoption because of stacked Genetically engineered upland cotton traits,i.e.,introducing HT and Bt traits in the HT only Bt only Stacked All same plant (Section 2.1). In 2008 stacked va- 1996 2 15 NA2 NA2 rieties of corn made up 40% of acreage and 1997 10 15 NA NA stacked varieties of cotton comprised 45% of 1998 26 17 NA NA acreage; in combination with individual traits 1999 42 32 NA NA this adoption accounts for 80%of corn and 86% 2000 26 15 20 61 2001 32 13 24 69 of cotton(Table 1).No stacked traits presently 2002 36 13 22 71 exist in commercial soybean varieties. 2003 32 14 27 73 2004 30 16 30 76 2005 27 18 34 79 8o 2.7.Does the Use of Genetically 2006 26 18 39 83 aEngineered Crops Result in 2007 28 17 42 87 .; Decreased Use of Pesticides? 2008 23 18 45 86 Having crops tolerant to herbicides and pest Genetically engineered maize iattack increases pest management options and HT only Bt only Stacked All 3 0 1996 3 1 NA2 NA2 3 .1) can also reduce the number and strength of pes- 1997 4 8 NA NA 3 ' ticide applications. Growth of GE HT crops 1998 9 19 NA NA � N also allows topical application of herbicides to 1999 8 26 NA NA b , crops and weeds, which replaces spraying be- 2000 6 18 1 25 o o tween crop rows and mechanical removal of 2001 7 18 1 26 o c.i weeds,both of which can damage crops and re- 2002 9 22 2 34 suit in environmental damage. Reducing me 2003 11 25 4 40 o chanical tillage lowers fuel consumption and 2004 14 27 6 47 a 2005 17 26 9 52 M helps conserve soils prone to erosion and com 2006 21 25 15 61 t"' action(173).HT crops can also lead to more rn P ( ) P 2007 24 21 28 73 o`4:: flexible herbicide treatment regimes. 2008 23 17 40 80 •,o Herbicide usage on HT GE crops has Genetically engineered soybean been analyzed in numerous studies. The Na- HT only Stacked All Lt tional Center for Food and Agricultural Policy 1996 7 NA2 NA2 a. (NCFAP)published surveys in 2000,2003,and 1997 17 NA NA Ix 2004 on U.S. pesticide usage on GE crops by 1998 44 NA NA c collecting information from industry experts, 1999 56 NA NA academic researchers,and Cooperative Exten- 2000 54 0 54 sion. In 2004, HT canola, cotton, maize, and 2001 68 0 68 soybean, as well as Bt cotton and maize,were 2002 75 0 75 2003 81 0 81 studied; reductions in herbicide active ingre- 2004 85 0 85 dient (AI) were 25 to 33% (259). In a 2006 2005 87 0 87 publication, the USDA National Agricultural 2006 89 0 89 Statistics Service (NASS) looked at both her- 2007 91 0 91 bicide and insecticide use,analyzing data up to 2008 92 0 92 2002.AI use rates for HT cotton and corn and Bt corn declined from 1996 to 2002 (figure 8 'Data for 1996 to 1999 from Reference 109;data for 2000 to 2008 from USDA Economic Research Service for cotton(299),for maize(298),for soybean(299a).HT,herbicide tolerant;Bt,Bacillus in Reference 108); overall reductions in pesti- rburingiensis. cede(herbicide+insecticide)use were observed 2Data for stacked traits and total all genetically engineered varieties not available. as adoption of Bt and HT cotton, corn, and www.annualreviews.org• Genetically Engineered Plants and Foods 521 soybeans increased. This phenomenon led to effects on surrounding soils and the potential an overall reduction of ca. 2.5 million pounds for rootworm to develop resistance(88). Al: active ingredient of Al, although slight increases in herbicide The reason all reports on pesticide usage do use with soybeans were found (109). The lat- not reach the same conclusions relates to the NCFAP: National ter increase is consistent with the fact that, as use of different data sets and/or different ways Center for Food and Agricultural Policy glyphosate application to HT soybean acreage of calculating pesticide use(178).Disagreement NASS: National increased, concurrent shifts occurred toward exists on which methods are most accurate to Agricultural Statistics less environmentally persistent herbicides(fig- calculate use rates,because they each reveal dif- Service ure 2 in Reference 174),such as pendimethalin, ferent aspects of herbicide usage. Regardless, Environmental trifluralin, and metolachlor (61). Taken to- certain parameters, such as agricultural prac- impact quotient gether,these results agree with many field tests tices used on and environmental conditions of (EIQ): a relative value and farm surveys showing lower pesticide use the acreages compared,should be similar when that estimates the for GE versus conventional crops (table 3 in comparing use rates. o environmental impact Reference 108). Measuring amounts of pesticide AI used is of a pesticide taking into account toxicity to Using the same data from USDA NASS helpful, but it does not provide adequate data wildlife,natural pests and other experts and extrapolating from trends on environmental effects (173), because each and humans,degree of when data were missing, another study also pesticide has different environmental and toxi- exposure,aquatic and found higher glyphosate use from 2002 to 2004 cological impacts.One means to take these fac- oterrestrial effects,soil on HT soybean compared with its use on con- tors into account uses the concept of an Envi- 3 chemistry,etc. ventional soybean but no increase from 1996 ronmental Impact Quotient(EIQ) (179). EIQ 0 o Acre: a unit of surface to 2001 (40). The increase in use from 2002 measures environmental and toxicological ef- area defined as an area P 22 yards by 220 yards, to 2004 was due in part to a switch to more fects on the basis of many variables: toxicity of ❑° equivalent to 4840 effective herbicide mixtures and to more re- the AI, its mode of action, period of time AI square yards or 43,560 strictive policies on herbicide use (174). Sim- persists,and ability of herbicide to contaminate square feet ilar conclusions were drawn for HT maize.For groundwater.Each AI in a pesticide has a spe- o EI: environmental Bt cotton, a trend was noted toward lower in- cific EIQ based on these parameters. o impact secticide rates on conventional cotton, due in An EIQ Field Use Rating is determined by part to single Bt varieties needing bollworm- multiplying the EIQ value by (a) the amount o directed sprays late in the season. Lower pes- of AI in a given amount of herbicidal product `'_06 ticide use rates were observed for Bt maize; and(b)the amount of herbicidal product applied 0 CV however,only part of conventional U.S.maize per acre.The smaller the EIQ Field Use Rating p is normally treated with insecticides.The rate number,the smaller its environmental impact. decreased in successive years,likely because of By calculating EIQ Field Use Rates for each c4) use of lower-rate insecticides such as cyfluthrin pesticide,impacts of different pesticides can be (40). A more promising approach for pesti- compared.EIQs can also be calculated for farm cide reduction for corn was the introduction worker health, consumer health, and ecology in 2003 of a GE variety expressing a modified (174). Cry3Bb1 protein(314),which protects against In 2006 the environmental impact (EI) of the western corn rootworm(Diabrotica virgifera cotton varieties expressing CrylAc and Cry2Ab virg ),a difficult-to-control soil pest with a was determined(177).Measurements of Bt pro- serious economic impact(206).To control root- tein expression, plant biomass, insecticide ap- worm, pesticides are often applied even when plication rates, AI measurements, and insecti- its presence is not known,because the economic cide EIQ values were used to produce an EI impact of the pest is often not known until treat- value,expressed as kilograms(kg)AI per hectare ment is no longer effective; losses from root- for conventional,single-gene,and two-gene Bt worm damage are often high. Environmental cotton from 2002 to 2003 and from 2003 to implications regarding adoption of this variety 2004. The average insecticide EI for conven- should be considered;these include ecological tional cotton was 135 kg AI/ha;for the two-gene 522 Lemaux Bt variety this value was 28 kg AI/ha as a re- to several studies prior to 2002 that focused suit of changes in both approach to insecticidal on AI quantities and economic effects of GE applications and reduction in usage.From 1997 crop adoption, this study estimated the EI of to 2004 in Australia the EIQ method was used to changes in pesticide usage(174)using 2004 data study the EI of Bt cotton(the single-trait variety collected by NCFAP(2 59) on herbicide usage CrylAc and the double-trait varieties CrylAc on GE and conventional crops in the United and Cry2Ab)(177).Pesticidal residues from the States.For HT canola,cotton,maize,and soy- plant were also considered but had little ef- bean, total quantities of herbicide AI used in fect on overall conclusions. Bt cotton had less general decreased from 25 to 30% compared EI than conventional cotton;the EI of CrylAc with conventional varieties; reductions in to- cotton was 53% that of conventional,whereas tal EI of herbicides used were also observed the value for the two-trait variety was 23%.In with GE versus conventional crops(table 1 in Canada,HT canola varieties,i.e.,glyphosate-, Reference 174).Reductions were also observed o glufosinate- and imidazolinone-tolerant vari- for total EI per hectare(39 to 59% reduction) • eties (Section 2.6), have been cultivated on a and for impacts on farm workers (40 to 68% large scale since their introduction in 1996.The reduction), consumers (35 to 59% reduction), EI of HT canola was determined from 1995 to and ecology(39 to 55% reduction).The num- c2000 using EIQ.Although HT canola acreage bers are generalizations based on the data used 3 ° increased from 10%in 1996 to 80%in 2000,the and could vary among locations.Notably these AI/ha declined by 42.8% and the EI/ha,based results are comparable to another study(55)in ,° h on EIQ and amount of AI for the herbicide, which a pesticide use footprint was calculated; declined by 36.8% (51). this study showed that the positive effects of cw A more global analysis of impacts of GE utilizing GE varieties were greater based on EI o ri crops using EIQ was performed in 2006,corn- per unit area than on Al quantities. • • paring typical EIQ values for conventional and When looking at herbicide usage and EI,it o GE crops and aggregating these values to a na- is important to note that in addition to use on mtional level (54). Assumptions were made to GE crops,herbicides can be applied directly to • perform these calculations; e.g., pesticide use conventional crops. Also, depending on weed 0.; levels were based on typical herbicide and pes- pressure, multiple applications can be used in ticide treatment regimes for conventional and the same area during the same season.Taking GE crops provided by extension and research these facts into consideration, glyphosate use advisors in particular regions(258). Given the per acre has increased dramatically from 1995 °'• caveats of the assumptions,the conclusion was to 2005, coupled with a concomitant dramatic a that GE crops resulted in significant reductions drop in the use of other herbicides(figure 3 in in the global EI of production agriculture(table Reference 174). Cultivation of GE HT crops 5 in Reference 54); e.g.,since 1996 the overall has also had other positive effects on the envi- EI associated with pesticide use on HT soybean, ronment,i.e.,increases in low-or no-till prac- corn,cotton,canola,and Bt cotton decreased by tices and use in combination with integrated 15.3%. pest management schemes (98), which were In 2002, under supervision of the Inter- made possible because early season pesticide national Union for Pure and Applied Chem- sprays could be eliminated,allowing beneficial istry, an international team from various fields insects to establish. of crop protection chemistry undertook a five- Most nonanecdotal analyses on AI usage year project to analyze pesticide use in GE ver- and EIQ focus on North America, mainly be- sus conventional crops and to estimate changes cause most GE HT crop acreage is in this in EI(173).They used data from public sources, region. Recently, an analysis of the potential including the scientific literature and reports EI of introducing HT crops into the Euro- published by various institutions. In contrast pean Union agricultural system was undertaken www.annualreviews.org • Genetically Engineered Plants and Foods 523 (175),despite the fact that acreage of GE crops insects (e.g., beetles), but this specificity is of- currently in the European Union is limited. ten not understood. Lack of understanding of Using large-scale experimental data for HT the narrow range of Bt,compared with insecti- sugar and fodder beets and to a lesser extent HT cides which control a broad range of soil pests, canola,it was concluded that amounts of herbi- caused Indian and South African farmers to cides used on HT beets were reduced,whereas use fewer pesticides to control nontarget, sap- those on HT soybean versus conventional were sucking pests of Bt cotton (210, 211), thus al- slightly higher;the latter observation is compa- lowing secondary pests,such as grubs and cut- rable to the situation in the United States.Be- worms,to cause damage(88). sides North America and the European Union, The first Bt GE crops controlled major other countries (e.g.,Argentina, China, India, insect pests, such as European corn borer and South Africa) grow large acreages of HT (Ostrinia nubilalis) and rootworm (Diabrot- and Bt varieties and pesticide usage has been ica spp.) for maize and bollworm (Helicov- o studied.Most reports indicate pesticide use and erpa zea)and armyworm(Spodoptera frugiperda, cost decrease following adoption of Bt varieties Spodoptera exigua) for cotton.At first only sin- (table 2 in Reference 174).In Argentina,num- gle Bt genes were used, thus minimizing col- bers of herbicide applications increased with lateral damage to nontarget insects, but this HT soybean but use shifted to more environ- strategy did not completely eliminate collateral ° mentally friendly herbicides(245). damage because some nontarget organisms be- ;' In summary, numerous studies have been long to the same group targeted by the Bt(Sec- 0 0 conducted on pesticide usage that analyzed tion 2.1). Since pests belonging to groups in- different data sets and methods, sometimes sensitive to that Bt were not controlled, they cw leading to conflicting conclusions. Some stud- were able to cause crop damage.This situation "' ies showed pesticide use, expressed as AI per was addressed with commercial introduction •\ unit area, decreased with introduction of GE of cotton varieties with two stacked Bt genes, HT and Bt crops; some studies showed in- for example, Cry 1Ac and Cry2Ab, which are ,7 M creases. More recently, studies have focused toxic to target bollworms and also to secondary on EI and these have shown reductions in EI, armyworm pests (70). Although not commer- oincluding on farm workers, consumers, and cialized, maize has also been engineered with o N ecology.Nonetheless, additional effort is nec- six insect resistance genes against lepidopteran oa essary to further reduce EI of agricultural pro- (CrylF, CrylA.105, Cry2Ab2) and rootworm t duction. This goal can be achieved by using (Cry34Ab1 + Cry35Ab1, modified Cry3Bbl) the best methods and tools available, includ- pests(139). ing integrated pest management, biocontrol, Another approach to increase the numbers organic production methods, and GE organ- of insects targeted by Cry proteins involves the isms(Section 2.17)to reduce EI while achieving use of domain swapping. Domains from one adequate production levels. family of Bt toxins that has three domains,each with a separate role in receptor binding and channel formation, were combined to gener- 2.8. Is It True that Bt Crops Need ate toxins with novel specificities.For example, Additional Insecticide Applications? a hybrid Cry protein with one domain from Bt or Cry toxins are toxic to susceptible lar- Cry1Ba and one from Crylla conferred re- vae when cleaved to generate their active form, sistance to both lepidopteran and coleopteran which then binds to specific receptors in the pests of potato (215). Directed evolution ap- midgut and creates holes that cause larvae to proaches are also used to create toxins with im- die(Section 2.1).The specificity of Cry toxins proved receptor binding(162). means that those aimed at lepidopteran insects Early efforts also focused on engineering (e.g.,butterflies)have no effects on coleopteran insect tolerance using plant defense proteins. 524 Lemaux Although many efforts led to partial resis- raised concerns that another virus would infect tance, there were two exceptions. Genes for the GE plant and, following recombination, a cc-amylase inhibitors from legumes,involved in novel virus would arise with altered virulence, CaMV cauliflower resistance to coleopteran seed weevils,were en- host range,or vector specificities. mosaic virus gineered into garden pea (Pisum sativum) and This concern arose from sequence analy- Selection pressure: other legumes; seeds were shown to be resis- ses of viruses,which indicated that homologous process by which tant to larvae of bruchid beetles and other field and nonhomologous recombination occurs be- favorable traits that are pests(212).These varieties have not been com- tween viruses and between viral genomes and inherited become mercialized in part because of possible safety plant genes(255).In fact,in laboratory demon- more prevalent in concerns(241).The second exception was the strations several viruses were shown to have vi- successive generations and unfavorable traits introduction of lectin genes from snowdrop ral genes in their genomes from other viruses become less common (Galanthus nivalis) into rice to control suck- that were introduced into the plant at the same ing insects, such as aphids and plant and leaf time(118,140,262,325).Experimental recom- o hoppers. Although these studies led to partial bination of a transgene into a cauliflower mosaic resistance to the rice brown planthopper(Ni- virus (CaMV) strain, unable to infect solana- laparvata lugens) (248), concerns over human ceous plants, resulted in a virus with altered • safety stopped the effort [Part I of this review symptomology and a host range that extended g 2 (186a),Section 3.21. to some Solanaceae(262).A similar recombina- 3 ° Other GE approaches in various stages tional event occurred between a tomato bushy of development involve use of insecticidal stunt tombusvirus mutant and a coat protein ,° compounds from nematodes (Heterorhabditis), transgene(48). bp bacterial cholesterol oxidase, avidin, volatile These and other results showed that re- communication compounds, and RNAi ap- combination does occur between transgenes o proaches targeted to specific insect proteins(see and viruses and recombinants can be recov- Reference 124 for a review).Even with GE ap- ered.Functional chimeric viruses have also re- a,N o proaches, other methods of insect control will suited from recombination between distinct - a M be needed, e.g., chemical pesticides, biocon- viruses (199), proving that novel viruses do °o M trol, integrated pest management, or organic evolve under natural conditions when two or approaches, because insects are plentiful and more viruses co-infect a plant. In fact, it is .o ever changing. more likely that novel viruses would arise from cross-infection in non-GE plants because num- hers of subliminal viral infections are high,thus 2.9. Can the Introduction of Virus- providing ample opportunity for viral recom- Resistant Genetically Engineered bination. There are also fewer constraints on Plants Lead to Novel Viruses? recombination between different viruses than The first commercialized GE plant in the between viruses and viral genes introduced into United States was viral-resistant squash, en- plant chromosomes (313). Experimental re- gineered with a viral coat protein gene sults indicate,however,that most recombinant (119). USDA APHIS deregulated the squash viruses are not fully virulent because the new (Section 2.14), allowing commercial produc- gene combinations are not fully compatible, tion after the virus was shown not to infect leaving new hybrids at a competitive disadvan- wild squash varieties.The resistance gene gave tage(255).To compete effectively,recombinant no advantage to wild squash varieties, and the viruses must have functional recombinational presence of the coat protein gene did not in- ability, capacity to establish systemic infec- crease viral competitiveness (176). Papaya was tion,and ability to compete with their progen- the second commercially cultivated plant en- itors during replication. These requirements gineered for viral resistance, also with a coat place powerful negative selection pressure on protein gene(189).Use of a coat protein gene newly evolved viruses.Reduced viral replication www.annualreviews.org • Genetically Engineered Plants and Foods 525 capacity could also negatively affect recombina- diation when plants are used. Nonengineered tion frequency in transgenic plants. bacteria and plants are able to remove heavy Given the complexities of host-pathogen x metals such as aluminum, selenium, mercury, environment interactions in the field, labora- and organic pollutants from contaminated soil tory and greenhouse experiments do not pro- by concentrating them in the cells of their roots, vide adequate information on frequencies and stems,or leaves(235,257).These natural pro- fitness of novel viruses.Fitness measured in the cesses can be made more efficient and more di- laboratory in experimental hosts(e.g.,Nicotiana rected through targeted modifications via mu- benthamiana) does not reflect field situations tation,classical breeding,or rDNA methods. where other factors, such as vector transmis- One phytoremediation effort has focused sion, alternate host range, viral accumulation, on selenium pollution, a worldwide problem and competition with other viruses,play a role. arising from refinery effluents, industrial However,a novel virus has in fact been observed wastewater,and discharges from electric power O4' naturally in the field where no GE plants were plants.Removal was achieved in the field using cA involved;this virus resulted from the recombi- fast-growing Indian mustard (Brassica juncea), nation of viral genes from two different strains which accumulates selenium to hundreds of of African cassava mosaic virus(113).Gene mix- parts per million (28). Other native plants ing likely took place during cross-infection by hyperaccumulate selenium to thousands of 3 ° two different viral strains in the same plant. parts per million and can grow in selenite-rich 3 a Large-scale field releases of plants engi- soils, although they accumulate little biomass ti neered with viral genes are necessary to obtain (83). Engineering Indian mustard with a gene a realistic assessments of the types and recombi- from a hyperaccumulater resulted in plants that cw nation frequencies that might occur.To date no produced greater biomass and longer roots,and novel viruses have been reported resulting from accumulation and volatilization of selenium GE plants in the field,but likely they would be was significantly increased (184). In field ex- o detected only if their appearance had adverse ef- periments, engineered Indian mustard plants, fects.At present,the only commercially propa- overexpressing adenosine triphosphate sulfury- gated plants engineered with viral coat protein lase,gamma-glutamyl-cysteine synthetase,and ogenes, GE squash and papaya, are grown on glutathione synthetase,were shown to contain small acreages(164).The possibility for viruses approximately three- to four-fold more sele- to pick up viral coat protein genes from GE nium in their leaves than wild-type plants(27). plants will be dramatically reduced in the future Mercury is one of the most hazardous heavy because strategies to create viral resistant plants metals and is particularly problematic in aquatic will employ methods,such as RNAi-mediated environments where organic mercury moves viral resistance(for a review see Reference 188), from fish to humans.Arabidopsis thaliana engi- that use short stretches of viral DNA,generally neered to express modified bacterial mercuric 300 to 800 bp (321), that do not encode pro- ion reductase detoxified mercury by convert- teins.For example,an RNAi construct used to ing the more toxic ionic form to a less toxic silence a gene from bean golden mosaic virus elemental form, Hg(0) (46). To address mer- in Phaseolus vulgaris led to virus-resistant plants cury pollution in riparian ecosystems, Eastern (47).Such approaches minimize the possibility cottonwood (Populus deltoides)engineered with for gene exchange among viruses. the same gene was shown to evolve two- to four-fold the amount of Hg(0)and accumulate 2.10. Can Plants and Microbes significantly higher biomass compared to con- Be Engineered To Improve trol plants in soils contaminated with 40 ppm the Environment? of ionic mercury, demonstrating the potential Cleaning polluted soil or water using living or- for in situ mercury remediation from soils(68). ganisms is called bioremediation or phytoreme- Concerns have been raised that this strategy 526 Lemaux might move pollution to the atmosphere,from such an event were to happen in the field, it which it would be redeposited onto land would be at very low frequencies and the gene (45). would need to provide a selective advantage to Km: kanamycin Another potential environmental advantage survive during generation advance. resistant of GE plants is making better use of resources Predictions regarding horizontal transfer npt: neomycin such as land and water. This goal can be were tested using DNA from sugar beet engi- phosphotransferase achieved by engineering plants (a) to achieve neered with a kanamycin resistance(Kmr)gene. higher yields using the same levels of inputs, Total DNA from GE sugar beet was spiked e.g., 12% increase in yield by engineering rice into sterile soil, to which were added nutri- with the Zea mays phosphoenolpyruvate car- ents and the bacterium Acinetobacter harbor- boxylase gene (181); (b) to incur fewer losses ing a neomycin phosphotransferase II (nptll) due to pests, by engineering potato (Solanum gene with a 317 bp deletion that caused it tuberosum) against late blight(Phytophthera in- to be kanamycin sensitive (Km') (227). Non- O°' festans)disease(278);and(c)to survive in soils competent bacteria integrated a fragment from with high concentrations of salt(3 36)or lower plant DNA that restored Kmr at a frequency of 5 levels of water(265).Lowering crop production 2.2 x 10-8, but only in sterile soils, a situa- losses reduces the likelihood that environmen- tion that would be unlikely to occur in nature. • tally sensitive areas will be cultivated, poten- On the basis of earlier studies, recombination • ° tially allowing maintenance or even expansion frequencies in nonsterile soils were 10-10 to • ' of protected forests,lakes,shores,wetlands,and 10-11 (126,226),and frequencies were further • tiwilderness. reduced in either soil type if no homology ex- c4 isted between donor and recipient DNA. o u"o Effects of selection pressure on persistence o2.11. Can Genes From Genetically of Kmr bacteria were assessed by adding in- q Engineered Plants Move to Bacteria creasing levels of Km to the soil.This led to the in the Field? conclusion that natural soil conditions rarely MTransfer of genes among nonsexually related would have the selective pressure necessary to ,o M organisms,e.g.,from plants to bacteria,is called keep nptll in the bacterium (227). Data from c:› horizontal gene transfer.It can occur in nature this and other studies indicate that homologous among sexually incompatible bacteria and may recombination and integration of plant genes • have played an important role in bacterial evo- into competent soil bacteria could occur, but j' lution(117). Horizontal transfer is in contrast at very low frequencies, and the environmen- • to vertical gene transfer, where an organism tal significance would depend on selective pres- receives genetic material from its parent or a sure for the trait.Thus,the nature of the gene, • species from which it evolved.Recent sequence whether naturally occurring or GE,would dic- analyses of genes and proteins show that some tate risk. genes have transferred from plants to bacteria (42,90);however,this exchange occurred over a very long evolutionary timeframe.Many factors 2.12.Is the Loss of Honeybees Due limit frequency of transfer, especially between to Genetically Engineered Crops? kingdoms such as plants and bacteria(42).The "Bees Vanish,and Scientists Race for Reasons," only successful recent demonstration of plant to quotes the New York Times in April 2007(29). bacterium transfer of DNA has occurred under Readers might worry about honeybees (Apis optimized laboratory conditions—situations melliferea L.) because of the honey they pro- difficult to replicate in natural settings (125). duce, but the greater effect would be because Numerous field studies have failed to show hor- they would not be available to pollinate almost izontal transfer at detectable frequencies be- 90 different fruit,vegetable,and crop species in tween plants and bacteria (53, 260). Thus, if the United States(76).In the latter case,a lack www.annualreviews.org • Genetically Engineered Plants and Foods 527 • of adequate honeybee populations could have vae consume only a small percent of their pro- serious consequences. tein from pollen(21,23),and there is also a lack CCD: colony collapse Honeybee die-offs had occurred before,e.g., of geographic correlation between GE crop lo- disorder in 1998 with the introduction of varroa mites cations and regions where CCD occurs. For FDA: Food and Drug into the United States, which resulted in de- example, CCD was reported in Switzerland, Administration clines in honeybee colonies from 80,000 in 1982 where no GE crops are grown (167). Other to 38,500 in 2004. But in spring 2007, colony causes have been suggested, such as exposure die-offs with new symptoms, termed colony to chemicals,pesticides and other stress factors; collapse disorder (CCD), occurred in several lack of genetic diversity in honeybees;and im- European Union countries,the United States, mune suppression(67).Several pathogens have and Canada(167). also been implicated,e.g.,a spore-forming par- A connection between Bt maize and asite,Nosema ceranae(297),and the Israeli acute CCD was raised in experiments conducted in paralysis virus(77). Germany that were described on the Internet but never published in a scientific journal(128). In these studies honeybees were fed Bt maize 2.13. Can Federal Regulatory pollen and although healthy bees had no acute Agencies Stop Planting of Genetically oor chronic toxic symptoms,in one experiment Engineered Crops That Pose 3 ° where bees were infested with parasites, the Environmental Risks? 3 ' study was aborted because Bt pollen appeared The United States created a formal regulatory o o to accelerate the bees'decline.Although not re- structure for GE organisms establishing the o peatable in subsequent experiments, Bt in GE concept that GE foods would be regulated on o w corn pollen thus became a possible cause of the basis of product, not process, and would o CCD. be regulated on a case-by-case basis(229)[Part •\ Prior to these experiments,however,numer- I, Section 2.6 (186a)]. GE crops and products o ous studies had determined the impacts of Bt made from them are under regulatory control of on bees: (a) Canadian scientists found no ef- three federal agencies:the Food and Drug Ad- c• fects of pollen from Bt sweet corn on honeybee ministration (FDA), the EPA, and the USDA mortality(24); (b)Mexican scientists found no (for a review, see Reference 201). The FDA effects of different syrups with Cry lAb protein is responsible for food safety and labeling of on bee colonies(247);(c)exposing bees to 1000 foods and animal feeds from conventional and times more Cry3b than in pollen resulted in no GE crops.The EPA evaluates food safety and toxic effects on bee larvae or pupal weight(15); environmental issues associated with new pes- a and(d)feeding honeybees pollen from Cry lAb ticides and pesticidal products,such as Bt corn maize did not affect survival, gut flora, or de- and the pesticidal Bt product it contains. The velopment of hypopharyngeal glands, where EPA's charge also includes GE plants in which protein-rich food for the brood is produced(20, a small part of a pest, such as a viral regula- 22,23).In 2008 a meta-analysis of 25 indepen- tory sequence (e.g., 35S promoter), is used. A dent studies assessing effects of Bt Cry proteins division of the USDA,APHIS, oversees envi- on honeybee survival (mortality) showed that ronmental safety of planting and field-testing Bt proteins used in commercialized GE crops GE plants to ensure GE crop field tests are per- to control lepidopteran and coleopteran pests formed under specified conditions and any un- do not negatively impact the survival of honey- usual occurrences are reported.All three agen- bee larvae or adults(91). cies do not oversee each GE crop;however,all Thus there are no data in the scientific lit- have legal rights to demand immediate mar- erature supporting direct or indirect damage to ket removal of any product if valid scientific bees caused by currently approved GE crops en- data show safety concerns for consumers or the gineered to make Bt proteins.Additionally,lar- en" 528 Lemaux A plant with an rDNA fragment inserted moval of a product from the market,it was the into the plant genome is considered a regu- court system that made inquiries regarding the lated article by USDA APHIS, and each time EI of two GE crops, one which had nonregu- Substantial a specific fragment is inserted it is considered lated status and one which had not yet requested equivalence: used to a new event [Part I, Section 2.6 (186a)]. Each such status.In the first instance,a U.S. federal determine whether a event must go through regulatory approval, court ordered the USDA to conduct more de- new food shares even if a first event with the same fragment tailed reviews of applications for experimental similar health and received approval. Regulated articles are eval- plots of GE bentgrass after it was shown that nutritional characteristics with uated for impact on the environment and on pollen had spread thirteen miles from the orig- existing,familiar foods agriculture,e.g.,will the gene move to a native inal cultivation site (320) (Section 2.14). The with demonstrated plant and perturb the ecosystem or become a second instance involved Roundup Ready®al- histories of safe use weed in a cultivated setting? Small-scale field falfa. In 2005 APHIS concluded that this GE EIS: environmental trials are used to make preliminary EI assess- variety was safe for animal feed on the ba- impact statement o ments. In the United States, the GE plant is sis of substantial equivalence; ^320,000 acres EA: environmental • a regulated article until APHIS deregulates it (129,500 hectares) were subsequently planted assessment [Part I, Section 2.6 (186a)]. To gain nonreg- in the United States. A U.S. District Court Adventitious ulated status, molecular, biochemical, and cel- Judge for the Northern District of California, presence(AP): lular analyses are done on the GE plant, and however,ruled that the USDA had erred in ap- technically 3 o data are collected on the life cycle,reproductive proving deregulation (9) and that nonregula unavoidable, 3 7 unintended presence characteristics, and expected and unexpected tion (Section 2.14) might have significant EI of undesired material changes versus a nonengineered plant. A pe- that required preparation of an environmen- in an agricultural bu tition for nonregulated status containing these tal impact statement(EIS). The court further commodity -a. o data is formulated by the event's creator and re- stated that the USDA violated the National En- o viewed by APHIS,after which an Environmen- vironmental Policy Act by preparing an envi- N tal Assessment can be issued and determina- ronmental assessment (EA) instead of an EIS •o Lion of nonregulated status granted.From June (11). After the court ruling in March 2007, m1992 to January 2009,117 petitions for nonreg- further plantings of HT alfalfa were prohib- b cn ulation were received at APHIS.Twenty-nine ited and restrictions were put on its production. were withdrawn or are incomplete;13 are pend- Roundup Ready®alfalfa returned to regulated o N ing; 75 petitions have received nonregulated status,pending submission and review of an EIS T status(160),including GE varieties of chicory, (11, 13). corn, cotton, flax, papaya, plum, potato, rape- • seed,rice,soybean,squash,sugar beet,tobacco, (4) and tomato. Information on status, requesting 2.14.What Happens When Pollen institution,genes introduced,phenotype of GE Moves From Genetically Engineered plants,field test data,and environmental assess- Crops to Wild Relatives or ments of deregulated articles is publicly avail- Non-Genetically Engineered Varieties?In Areas of Genetic able(160).Deregulation does not mean the GE Diversity? crop has been commercialized, only that it no longer requires APHIS review for movement Most plants reproduce via self-fertilization or or release(161). movement of genes from one parent to an- In 2005,the USDA Inspector General con- other via pollen. In fact, this process is an es- ducted an audit that indicated the USDA sential tenet of genetic diversity.But movement lacked basic information about where GE crops of unwanted genes,naturally occurring or en- were grown and their fate after harvest (155). gineered, may result in adventitious presence This finding raised concerns,particularly about (AP), a situation where unwanted substances crops that produce pharmaceuticals.Although unavoidably are present in production and mar- all three federal agencies can legally request re- keting of agricultural products. AP can occur www.annualreviews.org• Genetically Engineered Plants and Foods 529 for a variety of reasons,including gene flow,and trait in a commercial crop with wild relatives sometimes results in economic consequences in the United States was virus-resistant squash for commercial GE crops(75). (157). USDA APHIS determined the impact Generalizations about whether gene flow of gene flow of the GE trait to wild varieties; presents significant economic or environmen- the squash received nonregulated status (Sec- tal risks cannot be made for either convention- lion 2.13)and was grown commercially after it ally bred or GE crops;case-by-case evaluation was shown that viruses against which resistance is required.Many major agricultural crops are was directed did not infect wild varieties or in- sexually compatible with wild and/or weedy rel- crease their competitiveness(176). atives, and, if the plants grow in overlapping HT traits have been engineered into ma- regions,crop-to-weed or crop-to-wild relative jor U.S.commercial crops such as canola,corn, gene flow could result (16; for a review see cotton, and soybean. Whether gene flow of Reference 96).This outcrossing to wild popu- HT traits leads to more competitive,herbicide- o lations can result in new combinations of genes resistant weeds depends on factors such as that can improve, harm, or have no effect on species,location,and trait.One crop for which the fitness of recipient plants. Genes can also this might be a concern in the United States flow from wild relatives to cultivated crops,in- is cultivated rice,which outcrosses with peren- troducing new traits into next generation seed, nial,wild red rice(Oryza rufipogon Griff.),con- 3 ° but only affect the crop if it is replanted.Gene sidered a noxious weed in the United States. 3 transfer among plants may be a larger contain- Red rice is sexually compatible with cultivated 0 ment issue than unwanted pesticides, because rice,grows in many of the same regions,often b genes reproduce in the recipient plant(95). has overlapping flowering times, and thus is a cw Pollen drift is a major,although not the only, prime candidate for gene flow with cultivated conduit through which unwanted genes end up rice.Breeders generally try to avoid gene move- in crops.Numerous factors affect the frequency ment from red rice to cultivated varieties be- k o of gene flow resulting from pollen drift, i.e., cause of its undesirable traits,e.g.,awned seeds ° biology of the species, the environment, and and red pericarp.When GE HT traits were in- M production practices,and these should be con- troduced into cultivated rice, attention shifted o° sidered in developing strategies to minimize to the impact of genes moving into red rice.To gene flow.Successful cross-pollination requires study this, experiments were conducted to de- that parental plants(a)flower at the same time; termine gene flow rates under natural field con- a-' (b) be close enough to allow a vector (insect, ditions from cultivated rice to wild red rice and a' wind, or animal) to transfer pollen to recep- weedy rice(0.sativa f.spontanea)in China and tive females; and (c) produce pollen that can Korea,respectively(69).An HT gene and sim- result in embryos developing into viable seeds ple sequence repeat(SSR) fingerprinting were and germinating (for a review see Reference used to monitor gene flow,which ranged from 194). Successful pollination also depends on 0.01 to 0.05% for weedy rice and from 1.21 to the longevity of pollen viability and the dis- 2.19% for wild red rice.Although frequencies tance it must travel (96, 97).Also important is were low,gene flow did occur,emphasizing the whether the plant self-pollinates, as is the case need to avoid outcrossing when genes could en- for tomatoes,soybeans,and most cereal crops, hance the ecological fitness of weedy species.In or is open-pollinated, as in the case for corn another study,resistance to imidazolinone her- and canola,where pollen from one plant fertil- bicides, created by mutagenesis, not by engi- izes another. Gene flow is more frequent with neering,was used to assess gene flow and fitness the latter. of the recipient(79),a reminder that gene flow There are wild,weedy species in the United is not limited to GE varieties and its impact is States compatible with some existing or antici- dependent on the trait,not the means by which pated commercialized GE crops.The first GE the gene was created. 53 o Lemaux Numerous studies have evaluated pollen- creeping bentgrass (Agrostis stolonifera L.), a mediated, intraspecies gene flow from canola wind-pollinated, highly outcrossing, perennial to its wild relatives. One study evaluated the grass (320) (Section 2.13). Because bentgrass outcrossing of B. napus with wild relatives, has native,weedy relatives in the United States including B. rapa L. (rapeseed), Raphanus with which it outcrosses(39),transgene move- raphanistrum L.,Sinapis arvensis L.,and Erucas- ment to related-rost species and dissemina- tram gallicum(318).Hybridization between B. Lion of seeds and vegetative propagules were ex- napus and B. rapa in two field experiments was amined. Following a single growing season of —7% in commercial fields and ^-13.6% in the GE bentgrass, most transgene flow was found wild.Gene flow from GE B.napus to the other within 1.2 mi (2 km) in the direction of pre- three wild varieties was shown to be low(<2 vailing winds; limited gene flow was found to to 5 x 10-5);however,genes could move into 13 mi(21 km).Further study showed that nine the environment via wild B.rapa or commercial HT creeping bentgrass plants (0.04% of sam- o B. rapa volunteers. Analysis of 16 of these pies) grew —2.4 mi (3.8 km) beyond the con- types of studies identified major factors affect- trol area—six from pollen-mediated gene flow ing pollen-mediated gene flow from B. napus in the direction of prevailing winds and three (152),using either a donor plot surrounded by from dispersed GE seeds(250).Three years af- cci receptor plants(continuous design)or a recep- ter production halted in HT bentgrass fields, 3 ° tor field only on one side of the donor plot(dis- 62%of 585 bentgrass plants tested positive for continuous design). With continuous designs, the HT gene; 0.012% of seedlings from seed o o cross-fertilization averaged 1.78% ± 2.48% of HT plants were HT positive(335),suggest- -8 immediately adjacent to the donor plot and ing that under some conditions transgenes can w was fairly constant at 0.05% + 0.05% at dis- establish in wild populations after short expo- tances over ten meters (1 meter = 3.3 feet). sures.Although no long-term ecological studies •\ With discontinuous designs, outcrossing rates were done,it was suggested that herbicide ap- were 0.94% (f 0.51)next to donors and 0.1% plication or drift could lead to persistence of the M (±0.11) at distances over 100 meters. Thus, HT trait in wild plants(249). most outcrossing occurred in the first ten me- Prior to commercial release of HT alfalfa o° ters from the field,although numerous factors (Section 2.13),studies were done to assess gene CDr relating to the field, plant, pollen, and envi- flow in fields grown for seed and for forage(for • T ronment influenced the rate.Aside from pollen review, see Reference 310). Under intention- flow,volunteer HT populations can also arise ally poorly managed fields(20 to 50% bloom), ° via seed-mediated flow (143) and from feral gene flow from a forage field to a seed field a; populations(152). was <0.5% at 165 ft and 0.01% at 350 to An example of a trait moving from a corn- 600 ft (289). This type of information can be mercial GE crop to a non-GE variety is triple- used to establish distances and practices to min- resistant canola (146) (Section 2.3); this out- imize gene flow(310).Gene flow also occurs to come was predicted prior to release of the GE feral alfalfa, frequently found growing outside variety because of canola's tendency to outcross cultivation areas,and this type of gene flow is af- (36). The multiply resistant volunteers, with fected by the same barriers as other alfalfa gene two GE traits and one mutant HT trait,could flow,i.e.,flowering synchrony,presence of pol- still be controlled with other herbicides; how- linators,and distances between alfalfa fields and ever,their presence has decreased the utility of feral plants.Gene flow to feral alfalfa,which is HT canola(66).Movement of HT genes could less abundant and less conducive to seed set,can have been monitored more closely to prolong be reduced by decreasing feral flowers through the effectiveness of the HT varieties. frequent mowing or animal predation. A well-publicized study of pollen-mediated In areas of genetic diversity of plants re- gene flow involved precommercial GE HT lated to GE varieties,additional precautions are www.annualreviews.org • Genetically Engineered Plants and Foods Sir needed to reduce possible impacts of introgres- "...recombinant DNA technology (including sion of GE traits,when potential significant en- gene deletion,gene doubling,introducing a for- NOP: National vironmental consequences could occur,and to eign gene and changing the positions of genes Organic Program minimize this occurrence. For example, out- when achieved by recombinant DNA technol- crossing of GE HT rice with wild rice varieties ogy)." Excluded methods "do not include tra- has potentially significant environmental such ditional breeding, conjugation, fermentation, impacts, whereas gene flow of the vitamin A hybridization,in vitro fertilization or tissue cul- trait from GE Golden Rice is less likely to have ture"(224).Despite this ban on GE technology, such impacts.Where possible impact is signif- some argue that GE crops could fill a niche in icant, planting of GE crops near wild species organic farming(253). should be avoided or GURT-type technologies In the United States, organic production is could be used to prevent gene(s)from moving a process,not a product certification,and thus to wild varieties(Section 3.2). does not specify the nature of the food or in- '6" On the basis of published studies,gene flow gredient.Although organic farmers are not re- will occur when compatible plants are present quired to test for pesticides (4),AP of certain and thus GE traits can move and persist in unin- excluded materials,such as synthetic pesticides, tended plants.Even in the absence of gene flow, are permitted(5).Presence in an organic prod- CGE varieties can persist in the agricultural envi- uct of a particular pesticide at levels <5% of 3 ° ronment. For example, in Sweden, GE volun- the EPA's tolerances can be labeled and sold as gteer oilseed rape plants(0.01 plant per m2)were organically produced (221). Presently there is g observed ten years after a trial of GE HT oilseed no policy on acceptable thresholds for the un- bR rape(84).Farmers need to be cognizant of gene intended presence of GE materials in organic wmovement from GE crops and the possible per- foods or products.Problems of gene flow to or- sistence of GE varieties. For organic farmers ganic fields are similar in some ways to pesticide the presence of GE traits in their crops could drift to organic farms from aerial spraying.The o create a problem if a contract was signed lim- USDA set specific limits for pesticide presence Miting the presence of GE traits in their organic and minimal distances between fields and a sim- products(Section 2.15). Conventional farmers ilar approach could be developed for GE crops o should also be aware of transgene movement to if zero tolerance is not the goal(Section 2.16). o 00 a non-GE crop if it is intended for export or Because of the ban on GE crops in organic Tother sensitive markets(Section 3.4). farming, some believe an organic farmer will automatically lose his/her accreditation if the crop is unintentionally mixed with a GE crop 2.15.What Happens When Pollen (252).The presence of detectable levels of GE c Moves from Genetically Engineered material in a crop does not constitute a vi- Crops to Organic Crops? olation of National Organic Program (NOP) Organic farming is a production system in regulations nor is it reason to lose accredita- which, among other restrictions, synthetically tion, as long as the grower has not intention- produced fertilizers and pesticides are not per- ally planted GE seed and has taken reasonable mitted; control of biotic pests is accomplished steps to avoid cross pollination (252; for spe- by biological pest control and nonsynthetic pes- cific wording of NOP standards,see Reference ticides such as copper,rotenone,and Bt(252). 220).The USDA-NOP informed state agricul- Although some GE crops are engineered to tural departments that up to 2005 no organic produce Bt, use of GE crop varieties in cer- farmer had lost organic certification because of tified organic farming is specifically prohibited AP of GE material (172, 291). However, the (252).To be sold or labeled as 100% organic, organic farmer might lose income from GE the product must be produced and handled presence, if the product is being provided un- without use of excluded methods that include der a personal contract guaranteeing a 100% 532 Lemoux GE-free product.This is not an NOP rule but or AP is the unintended occurrence of materi- a private agreement between grower and buyer als other than the specific crop and can include (171). weed seeds, seeds from other crops, dirt, in- E enzyme- Some consumers,however,expect foods la- sects,and other foreign material,such as stones linked immunosorbent beled as organic not to contain GE ingredients or plastic.For seed crops,rules for AP are speci- assay and have zero tolerance for their presence. fled by the Association of Official Seed Certify- AOSCA: Association Achieving 100% purity for any agricultural ing Agencies(AOSCA).For example,a level of of Official Seed commodity is a practical impossibility given the 0.5%seed of other varieties and 2%AP of inert Certifying Agencies nature of our food system,the reproductive bi- material is permitted in "pure seed" of hybrid ology of plants, and the highly sensitive de- corn seed(172). tection methods available to identify GE traits Historically,dealing with practices of neigh- (270). These latter methods include PCR as- boring farms has been handled by farmers says, which require knowledge of the DNA working with each other to minimize impacts. o sequence introduced (78), and enzyme-linked This situation occurs, for example, when syn- immunosorbent assays (ELISA), based on an- thetic pesticides are used on conventional farms tibodies specific for the introduced protein. and organic farming is being practiced on ad- These testing methods establish GE presence joining fields. This situation can cause eco- g and can result in extra costs to the producer; nomic losses for the organic farmer when pro- 3 ° however,not conducting such tests could mean hibited pesticide residues (222) occur at levels also extra costs because of rejection at the point >5%of the EPA's tolerances,because the prod- of sales. uct cannot be sold, labeled, or represented as organically produced (223). Thus, coexistence co strategies must be devised to allow both neigh- o 2.16. Can Organic, Conventional and hors to farm in an economically viable man- Genetically Genetically Engineered Cropping ner. This can involve alerting each other to • Systems Coexist? their plans and modifying them to accommo- o The coexistence of differing varieties and pro- date each others' needs. When GE crops are M duction methods is not new to agriculture. grown next to organic farming operations,cer- Breeders and farmers have developed strategies tain practices that minimize synthetic pesti- N to grow and market different varieties,such as cide drift can also limit GE gene flow, such o • T a white and yellow maize,hot and sweet peppers, as spatial separation of fields, staggered plant- high- and zero-erucic acid rapeseed, and still ing dates, and planting varieties with different ° achieve purity standards dictated by certified maturity dates and those that are not sexually seed specifications. When producing crops in compatible. Other crop-specific methods have or for countries where labeling thresholds exist been devised to aid coexistence strategies (52, for AP of GE products (Section 2.14), meth- 153,244).Gene flow is not the only means for ods must be established to separate different GE to commingle with conventional or organic product lines to enable coexistence so the eco- crops;crops must also be segregated during har- nomic needs of all farmers can be met (156) vest,shipping,and processing.Methods limit- (Section 3.4). ing such commingling have in some cases been Farmers also have to choose among van- implemented(52, 59, 153,233,244). ous production methods to grow their crops;it The European Commission on Agriculture is not uncommon for different farming systems and Rural Development adopted guidelines in to be used on adjoining fields. Thus, farmers 2003 for the development of national strategies have to deal with mixing of permissible inputs and best practices in the European Union to en- and methods,whether within their own farms, sure coexistence of GE crops with conventional with products from neighboring farms,or dur- and organic farming (72). Individual Euro- ing harvest and processing.This commingling pean Union countries have developed their own www.annualreviews.org • Genetically Engineered Plants and Foods S33 coexistence strategies (129), which has led to of the same crop,use of buffer rows,and spec- differences in the legal and economic situations ified agronomic practices, such as rouging of within the European Union(37). Country-to- undesirable plants,weed control,and detassel- country growing conditions are so varied and ing(60). This type of approach could also as- experience with GE crops is still so limited that sure reasonable purity standards for commin- it is difficult at present to develop unified leg- gling of GE in agricultural products.When UK islation on coexistence. The European Corn- officials drafted DEFRA guidelines,they recog- mission is set to release a report describing the nized that rules need to be achievable because development of national coexistence measures the more complex the system, the more likely (130). farmers would be to err or ignore the rules(34). In 2006 the UK DEFRA outlined a proto- Also critical is establishment of accurate meth- col on how to manage coexistence,with stricter ods to test for GE presence, availability of a standards for coexistence with organic products testing facility, an economical cost for testing, (86).The aim was to ensure future growing of established liability criteria,and compensation GE crops without resultant disadvantages to schemes once GE presence is detected(202). any farmer. The legislation establishes statu- tory separation distances between compatible o ' GE and non-GE s cro which are specific for 2.17. Can Use of Genetically crops, p Engineered Crops or Organic 3 ° each crop and which account for the size of re-3 ceptor and donor fields,and a statutory notifica Farming Lead to More Sustainable o Agricultural Production Systems? o tion process to inform neighboring farms.Non- 0 a statutory recommendations include control of Sustainability has no single meaning, but one volunteers and bolters (sugar beet) and clean- accepted definition is to meet the basic needs of o ing of shared combine harvesters.Feedback was today's inhabitants while preserving resources sought from stakeholders(130)with the intent to enable future generations to flourish. Sus- o that by the time GE crops are released in the tainability has become a goal of the United o ,7 M United Kingdom appropriate coexistence mea- Nations' Development Group's Millennium sures will be in place.To facilitate spread of in- project, "to `Ensure Environmental Sustain- sformation and compliance,a web-based Coex- ability' by integrating principles of sustain- istence Information System was created to share able development into a country's policies and Tinformation on studies being conducted in in- programs to reverse the loss of environmental dividual European Union countries on specific resources" (295). Although the need for sus- GE crops(131). tainable agricultural systems is now widely ac- '(2" One factor hampering coexistence is the cepted,the manner in which to achieve them is demand for zero tolerance for GE presence. not universal and even the precise goals are not Achieving 100%purity with any biological sys- well defined. tern is impossible and would require a complete The prevailing agricultural system in the ban on growing GE crops.In the United States United States,so-called conventional farming, AOSCA sets "minimum standards for genetic has led to impressive gains in productivity and purity and identity and recommended mini- efficiency. Some estimates are that between 70 mum standards for seed quality for the different and 90%of recent increases in food production classes of certified seed" (17), and this is made resulted from changes in conventional agricul- possible through coordinated efforts of official tural practices rather than cultivation acreage seed certification agencies that evaluate, doc- increases(132).This high production does have ument, and verify that a seed or plant prod- negative environmental impacts,as well as size- uct meets accepted standards (49). Mandatory able consumption of fossil fuels,unsustainable practices are established by state affiliates of rates of water use and topsoil loss, and con- AOSCA that set isolation distances from fields tributions to environmental degradation, e.g., S34 Lemma air pollution,soil erosion,reduced biodiversity, are deployed and whether their use results in pest resistance,pollution of lakes and streams, changes in farming practices that increase sus- and overuse of surface and ground water(149). tainability. To achieve true sustainability agri IPM: integrated pest To achieve agricultural sustainability,causes culture must use the best of all practices. management and cures for these problems must be addressed through all possible means.Numerous agricul- tural practices or methods, such as integrated 3. SOCIOECONOMIC ISSUES pest management(IPM),biological control,or- When considering effects of GE crops and ganic methods, and use of GE plants, coupled products,just as with those produced by other with selected conventional agricultural meth- agricultural methods,it is important to factor in ods,can play important roles in future sustain- economic and social implications. In this sec- able agricultural practices. For example, prac- tion, consideration is given to impacts of GE titioners of integrated pest management use crops on farmers and their practices, to the on comprehensive information on the life cycles mechanisms of agricultural change, and to ef- 3 of pests and their interactions with the envi- fects on developing countries.Not all issues of ronment, in combination with available pest interest are discussed.Perhaps more difficult in control methods,to manage pest damage with these subject areas is the fact that there are not the least possible hazard to people, property, always definitive,factual responses to the issues 3 ° and the environment(104). Biological control raised; responses often reflect attitudes rather ' involves the use of a specific living organism than information based on peer-reviewed sci- • y to control a particular pest and cause the least entific literature. 0 harm to beneficial insects(228).USDA APHIS, o o for example, recently released a finding of no o significant impact relative to the environmental 3.1.Why Do Farmers Plant • release of gall wasp(Aulacidea acroptilonica)for Genetically Engineered Crops • biological control of Russian knapweed(A and Who Profits From Them? tilon repens)(12).Biological control can be a part Whether measured as crop yield per acre or av- M M of an IPM strategy and neither biological con- erage output per farm worker,U.S.agricultural o trol nor IPM specifically excludes the use of GE productivity is among the highest in the world o N organisms. and it has increased over time. In 2004, total 'm Organic production(Section 2.15)relies on agricultural productivity was 2.7 times higher practices, such as cultural and biological pest than it was in 1948 (120). Nonetheless, farm- • management, that can include IPM and bio- ing is at best a low profit margin endeavor,and z logical control but excludes the use of synthetic profitability often depends on factors outside chemicals and GE organisms(300).The use of the farmer's control, e.g., weather, pest infes- • GE organisms can also contribute to sustain- tation, and market fluctuations. However, ex- able practices by augmenting and replacing cer- pected profitability plays a large role in deci- tain conventional practices.For example,plants sions by farmers to adopt new innovations. can be created that increase water use(2 51)and GE varieties can have potential positive eco- fertilizer(271) efficiencies, that remediate soil nomic impacts, but certain factors should be contaminants(183),increase no-till or low-till kept in mind. (a)The nature and performance practices(280)to help reduce greenhouse gases of GE varieties change over time and in differ- (92),and produce higher yields without increas- ent locations.(b)No single method of assessing ing land usage,particularly in developing coun- net economic impact of new crops is sufficient tries (41, 246). Although GE plants can con- to accurately predict outcomes. (c)The length tribute to a more sustainable agriculture, their of time over which particular varieties are used development and availability do not ensure pos- influences assessments(273).Economic studies itive contributions.That depends on how they should also take into account impacts on labor, www.annualreviews.org • Genetically Engineered Plants and Foods 5 3 f health,environment,equity,and poverty.Con- costs. A literature review in 2007 concluded sideration of all these latter factors distinguishes that economic benefits of Bt maize in reduc- ERS: Economic GE crops from other modern varieties because ing the mycotoxins, fumonisin and aflatoxin, Research Service risk assessments and the potential impacts of were ^-$22 M and $14 M, respectively (331). GE crops relative to these factors play larger Mycotoxins are a significant health issue where Mycotoxins: toxic secondary metabolites, roles in acceptance of GE crops than for those unprocessed corn is a dietary staple(332), and such as aflatoxin and created by traditional practices. thus,health benefits from mycotoxin reduction fumonisin,produced One important factor for farmers in consid- are particularly important in developing coun- by certain species of ering crop profitability is yield.Although cur- tries.When considering exports to these coun- fungi or molds rent GE crops are not engineered for higher tries, the health situation could be improved yield per se, increased yields have been ob- by stricter mycotoxin standards;however,these served. This higher yield has been demon- standards would have negative economic im- strated in numerous studies and surveys of pacts on major corn-exporting countries, i.e., HT corn, Bt cotton, and Bt corn (table 3 in the United States,China,and Argentina(331). Reference 108). Data analysis of the USDA In the European Union, GE crops are Economic Research Service's (ERS) Agricul- planted on a limited area. Of European Union tural and Resource Management Surveys of member countries, Spain grew the largest I G 2001 to 2003 showed that most farmers, e.g., acreage(250,000 acres,0.1 million hectares)in 3 ° 79% of those choosing Bt corn, adopted GE 2007 (165). In fact, Spain has grown commer- varieties to increase yields through improved cial Bt maize for more than nine years; 15% of ,° N pest control(figure 7 in Reference 108).Other their total acreage is composed of Bt varieties bi, reasons included time savings and ease of agri- and in regions with high corn borer infestation wcultural practices. it can reach 60%(133).Economic analyses were In determining the profitability of Bt corn performed using data from face-to-face surveys C7,\ engineered for European corn borer protec- with Spanish farmers in the three leading Bt o tion, it is important to note that farmers must corn-growing regions that accounted for' 90% decide whether to purchase the more expen- of cultivated GE corn in 2006.A statistically sig- °o M sive Bt corn seeds before they know what the nificant(P < 0.001) 11.8% yield increase was oextent of insect damage to their crop will be. observed in one region,Zaragoza,during three o6 In years when corn borer infestations are high, growing seasons,with lesser increases observed oN farmers make a profit primarily because of in- in the other two regions.Yield variation in these creased yields. When insect pressure is low, latter areas could be due to use of unadapted a. yield losses to insect damage are slight and seed Bt varieties and to variations in pest pressure, rx costs exceed profits(182,326).Aside from yield but it is not due to Bt resistance development considerations,another economic benefit of Bt in corn borer populations(133).In one region, corn is reduction of mycotoxins present in grain total revenues minus variable costs for Bt farm- because of infection by toxin-producing fungi. ers versus conventional farmers were as high as The most prevalent impacts are due to aflatoxin, ^-$69 per acre per year higher,which compen- with lesser effects from F? mycotoxins, sates for the price premium on seeds. Similar or fumonisins,and deoxynivalenol(DON)also yield advantages were observed in South Africa called vomitoxin because it induces vomiting (137).The Spanish surveys revealed that most and hemolysis of erythrocytes in animals.These farmers adopted Bt corn to lower corn borer compounds are known to cause a variety of damage;the main reason for not adopting was short-and long-term health effects.Bt reduces reluctance to change. insect damage on kernels,thus reducing infec- Seven other European Union countries tion by mycotoxigenic fungi (25). Economic grow smaller acreages of GE crops than losses are due to market rejection of contam- Spain: the Czech Republic, France, Portugal, inated grain, export market losses, and testing Germany, Slovakia, Romania, and Poland 536 Lemaux (165).In 2007 the Czech Republic grew^-1.23 term "terminator technology" in 1998 in a million acres (0.5 million hectares) of GE patent issued jointly to Delta & Pine Land maize; additional income for Bt maize in the Company and the USDA (315). This tech- many areas of high infestation was as high as nology was described as a means to restrict 2430 Czech koruny($145)per acre(123).Sim- reuse of GE seeds; second-generation seeds ilar analyses for HT sugar beet showed that, would be sterile(230)and could not germinate taking into account treatment of HT sugar beet (144). and additional seed costs, farmers could still Terminator technology is one form of achieve a 1620 koruny ($96) additional profit GURT;there are two types,V-GURTs(variety- per acre. protected GURTs) and T-GURTs (trait- Studies on economic impacts on farmers in specific GURTs). An example of plants with developing countries have also beearconducted. V-GURTs would be those with terminator One study in India showed increases in yield and technology.Because saved seeds would not ger- revenue with Bt cotton compared with non-Bt minate, users would have to repurchase seeds cotton using farmer plot rather than trial plot each year—similar to the situation with hybrid data,although there was some variation among crops that must be purchased yearly to real- subregions(211)and a few areas did not bene- ize yield advantages (115). Hybrid seed use, fit(41).Yield increases in India improved when which represented 95% of U.S. corn acreage 3 ° coupled with IPM practices(Section 2.17)(26). in 2006 (309), would not be affected by the oA study of farm-level preproduction trials in use of terminator technology and users' hav- 4: o China showed that compared with households ing to repurchase seeds because farmers using v4 cultivating non-GE rice, small and poor-farm hybrid seed must already repurchase seed each ahouseholds, without the aid of experimental year. Crops engineered with T-GURTs must o station technicians, realized both higher crop be treated with specific chemicals for the engi- •\ yields and reduced pesticide use after adopt- neered trait to be expressed.In this case,farmers ing GE rice varieties (150). In some studies, could replant seed but would lose the advantage Mfarmers in developing countries realized greater of the trait if their crop was not treated with VD M yield benefits from such crops than in devel- the chemical,something RAFI termed"traitor ooped countries. It was suggested that this re- technology." `'oci suit was caused by small-scale farmers suffering Terminator technology was complex as o 'pa larger pest-related yield losses because they do patented, involving several genes, with one not have the technical or economic resources stopping protein synthesis and preventing seed to manage pest infestations(41, 246).To real- germination.So that the planted seed could a ize the greatest economic benefits in developing tially grow,this gene product was not expressed countries, it is important, when selecting GE in the first generation,but was instead halted by targets,to consider local production conditions, a spacer gene under control of the cre/lox sy consumption preferences, appropriateness of tern.Cre recombinase excised the spacer,strad- local varieties,adequacy of biosafety regulatory died by lox excision signal sequences, which policies, and possible impacts of marketing is- activated expression of a second gene, which sues and consumer attitudes(94). halted germination and encoded a ribosomal in- hibitor protein(RIP),under control of a third gene product for the TN10 tetracycline re- 3.2.Will Plants with Terminator-Type pressor. Use in tobacco and cotton was de- Genes Prevent Replanting of scribed in the patent as functional but efficacy Genetically Engineered Crops? was not shown.The system required functional The Rural Advancement Foundation Interna- and timed expression of three genes,making it tional[RAFI,now ETC(Erosion,Technology, problematic as a commercial approach, and in and Conservation) Group] (256)first used the fact,the system has not been commercialized. wvnu.annualreviews.org • Genetically Engineered Plants and Foods 537 Terminator technology has been criticized the research, development, and regulatory ap- by some farmer and consumer groups as po- provals(Section 3.5)needed to bring products tentially disastrous for food security and bio- to market. IP rights provide legal protection diversity (266). After criticisms surfaced in for ideas and products (180) and these rights 1999, Monsanto, then owner of the technol- have been key to securing the economic re- ogy, vowed not to use it; other seed compa- turns necessary to compensate for the substan- nies also agreed.Controversy over the technol- tial investments required to market GE crops ogy reignited in 2005 because of a statement (14). Patents can also ensure that results and in Monsanto's Pledge Report to Stakeholders, techniques needed for inventions are ultimately "Monsanto does not rule out the potential de- made public, although actual use of the IP is velopment and use of one of these technolo- restricted to license holders of the technology. gies in the future" (208).This controversy led Without this protection,situations could arise to the introduction of a bill into the Canadian where findings are not published and processes Parliament in May 2007 to"prohibit field test- are kept secret.The legal system provides ways ing and commercialization of Terminator seed to protect IP through patenting of not only GE technology."In May 2008 worries surfaced that crops,but also the tools(e.g.,genes,methods) a global ban on terminator technology would be used to create them. g rescinded at a United Nations'summit on ge- To ensure that investments made in creat- 3 netic diversity, but the issue was not discussed ing these crops are recouped, seed producers 3 ° (74).One concern raised about V-GURT plants require purchasers of patented GE seeds to sign is that they would cross-pollinate with non-GE agreements stating that they will not reuse or bF plants such as compatible wild relatives or crops sell the seed,and thus growers must repurchase win fields of farmers not wishing to adopt GE seed each year. This situation is not the first crops,and become sterile.Although V-GURT instance of farmers' not being able to reuse •N plants were sterile,some worried that the steril- seed.In the United States in the 1920s the in- ity trait would occasionally not be expressed, troduction of hybrid maize seed (275) meant , become activated,and cause sterility.Given the that farmers had to buy seeds each year to cap- °o complexity of the technology,sterility in non- ture yield benefits(Section 3.2).Although legal oGE plants caused by cross-pollination would be agreements were not involved, the hybrid was "' highly unlikely to occur. a type of"biological patent"that prevented re- ON i4 A positive aspect to using such technologies planting because farmers were unable to create is to inhibit effectively the flow of undesirable hybrid seeds without the inbred parents,which GE traits to compatible relatives. It might be were protected by the companies that produced rx prudent,for example,to limit the flow of genes the hybrid seed. that could give growth or pest-resistance advan- Despite potential benefits, patenting in tages to wild relatives or that encode vaccines, many cases has impeded the use of technolo- . antibodies, or industrial chemicals. Use of V- gies and development of commercial products. GURTs thus would slow the movement of GE It has often been difficult or impossible to ob- traits,which could be particularly important in tain the multiple rights needed to develop and regions of high genetic diversity. market GE crops.One widely publicized exam- ple is Golden Rice,where a large number of IP issues had to be resolved before the engineered 3.3.Why Are Genetically Engineered genes responsible for provitamin A production Crops Patented?Does This Affect could be introduced into local varieties in de- Farmers in the United States veloping countries(180; Part 1, Section 3.21). or Developing Countries? However, it should be noted that the major Companies developing the new GE crops in- problems actually related to material transfer vest substantial amounts of time and money in agreements rather than patents because very 538 Lemaux few relevant patents had been issued in major patents on most of the technologies needed to rice-consuming countries(44). develop GE plant varieties;however,in the past In the private sector, obtaining enabling these technologies and other materials neces FTO: freedom to rights has often been accomplished by bringing sary to create GE varieties have not been pro- operate key technologies and materials under the con- tected properly for public sector use.Open pub PIPRA: Public trol of the company through mergers and ac- lication or careful reservation of patent rights Intellectual Property quisitions(330).Large agricultural biotechnol- for public and nonprofit use can address this de- Resource for ogy companies amassed IP assets through these ficiency.Public sector institutions need to sys- Agriculture means or through their own research efforts tematically retain rights to inventions that can — into the development of new GE crops (151). be used for subsistence and specialty crop de- However,the development of GE agricultural velopment and make them available to others products for farmers in developing economies for such purposes(19). and of GE seed for low acreage crops in devel- To this end, a number of public sector in- "o oped countries will most likely be performed, stitutions established PIPRA, the Public In- if at all,by nonprofit organizations with public tellectual Property Resource for Agriculture. funding(19). PIPRA developed a public IP assets database, The patenting of living organisms was first established best practices to guide development realized in 1980 when the Supreme Court de- of research innovations, and created specific, 3 ° cided in Diamond v. Chakrabarty that living, pooled public sector IP technology packages 3 ' man-made microorganisms could be patented. to facilitate humanitarian and special use ob- a E In the same year, the Bayh-Dole Act enacted jectives. This effort encourages collaborative b4 by Congress encouraged U.S. universities to research efforts among agricultural scientists wpatent innovations and license them to the pri- at different institutions while recognizing the o vate sector(213).These decisions led to striking need to protect and share key IP to make contri- increases in public sector patents and licensing butions to research for the public good.By 2009 ° of patents to the private sector. Licensing of PIPRA has brought together IP from more than inventions to the private sector often prevents 40 universities, public agencies, and not-for- V7 " public institution researchers from using ma- profit institutes(238). terials and methods invented within their own o N walls to further innovate and create improved commercial agricultural materials(73). 3.4. Does the Export Market Affect No single public institution has the coin- Decisions by Farmers to Grow plete set of IP rights needed to ensure the free- >: Genetically Engineered Crops? dom to operate(FTO)to develop a GE product Strict rules regarding GE presence in seeds and (85).Although problems with regulatory costs foods for international markets are a key driver (Section 3.5) and public acceptance also exist, for the need to segregate crops, but a lack of FTO is a major barrier to having all the nec- standardized,internationally accepted market- essary tools to commercialize a GE product. ing standards, testing methods, and protocols In a study aimed at better understanding this poses significant challenges to the smooth op- problem,it was revealed that approximately one eration of the domestic and international agri- quarter of patented agricultural biotechnology cultural marketplace(233). By the same token, inventions were actually created in public sector this situation provides a marketing opportunity institutions, which is substantially larger than for those who can successfully navigate the tan- the IP portfolio of any individual agricultural gle of regulations and deliver acceptable prod- biotechnology company (138). However, that ucts.The United States must work toward in- IP is often scattered among institutions and is ternationally accepted,science-based standards often licensed exclusively to entities that restrict for trade in GE products that include sampling its use.In general,public sector scientists have and testing methods and tolerance levels that www.annualreviews.org • Genetically Engineered Plants and Foods 539 result in fair trade practices and that lead to un- imposed undue delays in the European Union restricted shipment of products in international (327). Europe now faces increased pressure to WTO: World Trade markets. allow planting of GE crops. The European Organization The United States exported^$26.8 billion Union did not appeal the WTO's decision that in agricultural products in 2007 (308). The the de facto moratorium and product-specific European Union and the United States are each approval policies were inconsistent with"suffi- other's major trading partners,resulting in the cient scientific evidence" and "risk assessment largest bilateral trade relationship in the world, requirements" dictated by the SPS (Sanitary with combined economies accounting for 37% and Phytosanitary)Agreement(328). of world trade (105). Presently the European In a 2008 background paper, the German Union has approved only a few GE maize va- food and feed industry associations expressed rieties for cultivation in member states (Sec- industries' concerns about the negative impli- tion 3.1). Imported foods, however, can con- cations of the European Union biotechnology tain GE ingredients that have been approved policy of zero tolerance for GE varieties that for food and feed and can be labeled non-GMO are not yet approved in the European Union in the European Union if they contain less than (1).The stated industry view was that"adhering 0.9% GE content; for Japan, the tolerance is to a zero-tolerance rule is not possible in inter- = ‘71 <5% and the tolerance is <1% for Australia national trade with agricultural commodities" • ° and New Zealand(304-307). In the European and further that "the German and European • ' Union there is zero tolerance for food imports food and feed industry will no longer be in the o containing unapproved GE ingredients.To aid position to obtain input materials on the world bU.S.farmers in choosing corn hybrids that are market." They called for establishing a toler- cw acceptable for international trade,the National ance for marginal content of GE varieties not o Corn Growers Association has a database of all yet approved in the European Union, a stance ••N GE varieties approved in the United States,in- also supported by the European Union Agricul- o dicating their approval status for import into tural Commissioner.The need to establish tol- Japan as either food or feed or import into erances might be driven by rising food and feed `v'• the European Union(219).Despite restrictions prices and also the possible needs for bioenergy oon export of GE varieties to certain countries, production(292). to; corn,soybean,and cotton are all grown in the What is the current situation with regard to o United States for export.A 2006 study reported exports?In 2006 the United States,which is the s' that 30% of global soybean production is ex- largest producer of corn,provided 42% of the ported and most exports come from countries world's supply of maize;of the 56 million met- C4')G growing GE soybeans (table 26 in Reference ric tons produced, ^-20%,was exported(293). 56). On the basis of size estimates of non-GE Thirty million metric tons of soybean and 260 soybean markets in the largest non-GE mar- thousand metric tons of cottonmeal were ex- kets of the European Union and Southeast Asia, ported(301).Agricultural exports in 2009 will 10%of global trade in soybeans is estimated to be worth an estimated$113 billion,with corn satisfy that market. representing $12.8 billion (302). In fact, the The reluctance to import GE crops and leading exporters of corn, i.e., United States, products into the European Union relates to Argentina, South Africa, and Canada, respon- a moratorium enacted in late 1998 to prevent sible for 80% of the trade,are all growing GE U.S. GE corn, cotton, and soybean products corn (56). There is a limited non-GE market from entering European Union markets(327). for corn,mainly in the European Union and to This moratorium led the U.S. government to a lesser extent Japan and South Korea, which file a formal complaint with the World Trade necessitates segregation of exports for these Organization (WTO). The WTO ruled that countries.Approximately 26%of global cotton 24 of the 27 approval procedures for GE crops production was traded,but there appears little Soo Lemaux effort to segregate GE and non-GE cotton ket is complex and the impact has been minimal (56).In agreement with these analyses,another compared with the natural volatility in these 2006 study concluded that export markets marketplaces(276). for identity-preserved non-GE crop varieties are fairly small worldwide (134). Also price differences at the farm gate for non-GE corn, 3.5.Who Is Commercializing soybean, cotton, and canola are not common Genetically Engineered Crops and are in general not enough to compensate and What Is the Outcome? farmers for growing non-GE varieties.Despite Data regarding food and environmental safety, what appears to be a relatively minor impact submitted by the developers of all GE crops, on exports, the potential for such impacts was have undergone testing and regulatory scrutiny given as a reason to rescind deregulation of by federal regulatory agencies (Part I, Section Roundup Ready® alfalfa (Section 2.13), likely 2.6). Costs of compliance with the biosafety because 75% of exported U.S. alfalfa goes to regulations varies significantly depending on Vl Japan,which banned GE alfalfa(169). the crop,trait,type of regulatory approval,and •L Japan is the largest importer of corn, in which and how many countries developers 16.5 M tons per year for food and animal feed, seek regulatory approval. Using data from in- most from the United States(293).In 2000 leg- terviews with scientists and regulatory person- 0 islation was introduced in Japan to prevent im- nel, submitted dossiers over a ten year period, ' ports of food products that contain GE vari- and cost data provided by developers of GE • ti eties not yet approved in Japan (303). Testing crops,compliance costs for Bt maize were esti- vfor GE presence is focused on GE products ap- mated at$7.1 to$15.4 million and for HT maize 0 o proved for commercialization in other coun- at$6.1 to$14.5 million(170).These costs are Etries,but not in Japan;if found,such products in addition to research and development,intel- av are rejected,destroyed,or diverted to nonfood lectual property, and technology transfer costs kr)• o uses (196). One repercussion of such regula- (Section 3.3). Private and public sector devel- Mtion is that farmers in developing countries re- opers face uncertainties in compliance costs and • sist growing GE crops because of the fear that outcomes of biosafety regulatory decisions that consumers in high-income importing regions, result in an impact on the product stream sub- such as the European Union and Japan,will re- mitted for regulatory review. The impact on oci o ject imports from any country that plants GE public sector efforts is more limited because • varieties(231).The segregation and traceability these developers often lack expertise and the • required to assure compliance further discour- physical and financial resources needed to com- rx age such plantings. plete the regulatory process. In summary,although there has been limited With the magnitude of these expenses it is loss of export revenue from some markets that perhaps not surprising that an estimated 80% were closed to GE products,the actual revenue of all GE traits receiving regulatory approval loss is far less than what was predicted because worldwide are owned or co-owned by four of product substitutions that occur in interna- major companies and their subsidiaries, Bayer tional markets(276).As long as there is another Cropscience (Monheim am Rhein, Germany), market for the goods produced and they can be Dupont (Wilmington, Delaware, United adequately segregated, farmers will be able to States),Monsanto(St.Louis,Missouri,United sell their commodities.Although acceptance of States), and Syngenta (Basel, Switzerland) GE products varies among countries, global- (170). Despite a considerable trait pipeline ization facilitates market substitutions and this from both public and private sector (186), to minimizes market acceptance issues for new date most GE crops on the market harbor products. GE crops have realized market fluc- Bt and/or HT traits. A summation of public tuations,but the international commodity mar- sector products created in or for developing www.annualreviews.org • Genetically Engineered Plants and Foods S41 countries also shows a sizeable pipeline of problem is that poor people cannot access the innovation, although most products have not available food,which is a major socioeconomic reached commercialization(18).Furthermore, issue(seep.24 in Reference 71).Food distribu- high regulatory costs are an impediment to tion is a critical issue.Food needed by the poor academic and government research institutions in developing countries is either not affordable and small businesses participating as major or cannot move efficiently from where it is pro- players in the commercialization of GE crops duced to where it is needed.A second issue is (50).This situation has discouraged the devel- that the plentiful food in developed countries opment of other GE traits and the introduction comes at an environmental cost, regardless of of these traits into crops with limited market its production method.Third,food choices af- size (201) and with further application in fect food sufficiency;for example more than 90 developing countries where GE crops could to 95% of energy and protein are used or ex- have significant impacts. A review of socio- creted when animals eat plants(seep.29 in Ref- "04 economic impact assessments of GE crops erence 71).In the United States it takes—7 kg in developing countries showed that, on of grain to produce 1 kg of pork,5 kg to produce average,the impact has been positive although 1 kg of beef, and 2 to 3 kg to produce 1 kg of with significant variability across regions, eggs or poultry.Fourth,population expansion, g[ countries, crops, and traits (273). Outcomes at the root of food in sufficiency, is predicted 3 ° have been limited mostly by institutional, not to continue for the foreseeable future, partic- 3 ;' technological, issues. As safe use continues to ularly in developing countries (294). A recent o c 4; o be demonstrated,further consideration should United Nations study stated that world pop- be given to controlling costs of biosafety ulation will increase from the current 6.5 bil- 0 o regulation and to enabling technology transfer lion people to 9.1 billion in 2050. Population oM to developing countries. in more developed regions will remain at^-1.2 al)N billion. In less-developed regions the 5.3 bil- • o lion will swell to 7.8 billion;even in 2007 food °0 3.6. Don't We Produce Enough Food was not plentiful for the 923 million chronically M to Feed the World Without undernourished in these regions(114),but this oGenetically Engineered Crops? problem will worsen in coming decades. Hunger is a complex problem with no simple Higher food prices exacerbate food suf- pia answer. It can be viewed from different per- ficiency problems and result from many spectives. For an entire population, hunger is causes, e.g., larger global demand for food, termed food shortage; for the household, it is local weather-related production problems,in- >: `1Z) termed food poverty; and for the individual it creased transportation and on-farm costs, and is termed food deprivation. Food shortage is increased use of some food commodities for one of the causes of food poverty, which in bioenergy production.Through improvements turn is one of the causes of food deprivation in agricultural practices and crops, there has (205). Hunger affects millions each year and been a steady rise in yields over the past decades, is only the most visible, and perhaps painful, but that rate is beginning to decline(57).New symptom of the problem of food shortages; methods and crop species are needed to pro- more subtle effects result from nutrient deft- vide higher yields on the same amount of land ciencies, which reduce the quality of life and in an environmentally friendly manner (181). impair human functioning and development. Yields can be improved through GE crops Severe hunger is most dramatic in Africa and (Section 3.1), particularly in developing coun- Southeast Asia, but is present in more subtle tries where disease and pests take a higher toll forms in all populations. on production. In addition,more efficient uti- Enough food is estimated to be produced lization of inputs and lower pesticide usage are worldwide to feed existing populations;a major necessary to meet increasing food needs while 542 Lemaux respecting resources and the environment.Sen- impact than food miles on carbon footprint and sible use of GE crops,along with other sustain- certainly on food sufficiency. able agricultural practices (Section 2.17), can help achieve this goal. Mere production of more food and its eq- CONCLUDING REMARKS uitable distribution, however, is not sufficient. The use of genetic engineering opens the door Many poor will still be malnourished. Glob- to improving agricultural crops in ways not pre- ally,the three deficiencies that can lead to seri- viously possible. But with this capacity comes ous health problems are in vitamin A,iron,and the responsibility to proceed with caution, in- iodine (296). Using GE approaches to create vestigating possible outcomes carefully. Con- crops with higher levels of minerals and vita- versely, there is also a responsibility to utilize mins (135, 269, 334) could, along with other the technology where it can provide improve- approaches, make progress toward alleviating ments to human health and the environment o malnutrition and allow people to lead more pro- and make farmers'efforts more productive.On ductive lives. the basis of the intensive look at the data in the Food costs in developed nations are inex- peer-reviewed literature cited in Parts I and II pensive.In the United States in 2007 less than of this review,it appears that the development gc 10% of disposable income was spent on food of GE crops to date has been responsible and 3 ° (301a). This situation has lulled consumers in regulatory agencies have,in general,proceeded ' some countries into a sense of security about the with caution in releasing GE varieties in the easy availability of cheap food,leading them to United States. -of complacent about the need to invest Although no human activity can be guaran- c o in agricultural research. Now that food prices teed 100% safe,the commercial GE crops and w are rising,arguably in part because of the use of products available today are at least as safe as •\ feedstocks for bioenergy production(288),peo- those produced by conventional methods.Par- ple are looking for ways to cut food costs and ticularly with regard to environmental safety, o the focus on global warming is causing them we must stay vigilant in our evaluation of GE cn "'• to think more about the carbon footprint of crops and their impacts to ensure long-term VD o our food system(322).Food is transported long utility,just as with those created using classical o N distances in the United States, i.e., 1640 km methods.Although we should exercise caution, (1019 mi)per delivery.But transportation is not we should not hold GE crops and products to the major contributor to the carbon footprint; standards not required for food and feed prod- 4.1'1 it is food production that contributes 83% of ucts produced by other technologies.With the the average U.S. household's carbon footprint proper balance of caution and scrutiny,we can for food consumption. Because different food take advantage of the power of this technology groups have different impacts on greenhouse without compromising the health of humans, gas emissions,food choices may have a greater animals,or the environment. SUMMARY POINTS 1. Foods consumed today derive from plants and animals in which the genetic makeup has been modified by sexual crosses and mutation.Use of recombinant DNA(rDNA),termed genetic engineering or biotechnology,provides a new tool to make genetic modifications. 2. Technically,researchers can transfer genes using rDNA not only within a species,but also from one kingdom to another. Commercially, only a few crops have been so modified, i.e., canola, corn, cotton, papaya, squash, and soybean; however, many others are in development. www.annualreviews.org • Genetically Engineered Plants and Foods S43 3. The environmental safety of genetically engineered(GE)crops and foods,just as with those created by classical breeding and mutation and grown conventionally or organically, must be evaluated on a case-by-case basis to perform meaningful risk assessments. 4. Information from the peer-reviewed literature on the safety of these products should be considered when growing and consuming foods from these crops. Factors beyond the technical,science-based facts should also be part of the decision-making process. 5. Although scientific testing and governmental regulation can reduce the safety risks of conventionally and organically produced and GE crops and food, 100% safety is not achievable. 6. Robust efforts should be made to conserve and enlarge global genebanks and collections on created to preserve precious landraces and wild relatives,which are the foundation for ° future classical breeding,marker assisted selection,and genetic engineering approaches. 7. On the basis of the bulk of data from field tests and farm surveys,pesticide use for GE crop adopters is lower than for conventional variety users.More importantly,extensive 2; data confirm that the environmental impact is substantially lower. 3 0 8. Transfer of transgenes is a larger containment issue than pesticides because genes repro- 4 duce in the plant. Generalizations about whether gene flow causes significant environ- mental or economic risks for conventional, organic or GE crops require case-by-case .g-0 ¢ evaluation. RS .. a w° 9. Adequate methods for the coexistence of differing varieties and production methods in o� Ca M agriculture are available and being encouraged worldwide;however,minimum standards, • N not zero tolerance, for GE presence need to be established for this approach to be wo O ,- attainable. ^, o 10. Farmers worldwide have adopted GE crops because of the realized economic benefits `O (which have been demonstrated in numerous studies),time savings,and ease of agricul- tural practices. Reluctance to adopt mainly relates to apprehensions about rejection in N the export market. A c FUTURE ISSUES 1. The introduction of pharmaceutical and industrial proteins into edible genetically engi- neered crops raises issues that require additional safety and regulatory scrutiny. 2. Coexistence measures that permit farmers to use production methods of their choice while respecting their neighbors' rights to do the same must be practiced to achieve economic viability for all farmers. 3. Interest in and funding for independent,peer-reviewed environmental risk assessments of conventional,organic,and GE foods must be encouraged. 4. Unified, rigorous, fact-based, and economically sustainable governmental regulatory policies must be put in place worldwide to allow public and private sector scientists to participate in creating GE crops. S44 Lemaux DISCLOSURE STATEMENT The author is not aware of any biases that might be perceived as affecting the objectivity of this review. ACKNOWLEDGMENTS The author acknowledges the incredible power of the Internet to both inform and confound. For this review the Internet provided ready access to search and read scholarly journal articles, but it also provided access to many other informational sources that often make it difficult for the average consumer to discern fact from fiction.It is with the goal of providing facts based on the scientific literature that this article was written.The author thanks Dr. Wilhelm Gruissem for encouragement more than a decade ago to begin addressing issues on agricultural biotech- nology in a scholarly manner and Dr.Petra Baettig-Frey for providing the first draft of some of ° these responses, available for more than ten years in the Biotechnology Information section of http://ucbiotech.org.The author is indebted to the long-term dedication of Ms.Barbara Alonso, who helped in preparing this manuscript and in maintaining an informational database that made writing this article possible.The author also thanks colleagues who read over drafts in their areas of 3 o expertise and provided guidance and missing information:Norman Ellstrand,Jose Falk-Zepeda, o Molly Jahn,Drew Kershen,Pam Ronald,Bruce Tabashnik,Allen van Deynze,and Brian Wright. � ccO 0 y.,. O E LITERATURE CITED ° 4, 1. Achilles D.2008.Discuss.Pap.German Ag-Industry EU Biotech Policy Implications.GAIN Rep.No. o GM8022.USDA For.Agric.Serv.Glob.Agric.Inf.Netw.(GAIN) •\ 2. AGBIOS. 2006. Database Product Description SYN-EV176-9 (176). http://www.agbios.com/ seor) dbase.php?action=Submit&evidx=31 - - 3. AGBIOS.2008.Search the GM Crop Database.http://www.agbios.com/dbase.php 3.Database for querying o r" 4. Agric.Mark.Serv.2008.U.S.Natl.Stand.Org.Agric.Prod.Handl.,Subpart A:Definitions.http://www. safety information on 01, ams.usda.gov/AIVISv1.0/getfile?dDocName=STELPRDC5069071 genetically engineered ° 5. Agric.Mark.Serv.2008.U.S.Natl.Stand.Org.Agric.Prod.Handl.,Subpart G:Residue Test.http://www. Plants and plants with o N ams.usda.gov/AM ld Sv1.0/getfile?dDocName=STELDEV3003539&acct=noprulemang novel traits produced using accelerated a 6. Alexander C.2005.Insect resistance management plans:The farmers'perspective.AgBioForum 10:4 mutagenesis and plant 7. Ali MI, Luttrell RG, Young SY. 2006. Susceptibilities of Helicovezpa zea and Heliothis virescens breeding. (Lepidoptera: Noctuidae) populations to CrylAc insecticidal protein. J. Econ. Entomol. 99:164- 75 8. Angle JS.1994.Release of transgenic plants:Biodiversity and population-level considerations.Mol.Ecol. 3:45-50 9. Anim. Plant Health Insp. Serv. USDA. 2005. Monsanto Co. and Forage Genetics International; availability determination of nonregulated status for alfalfa genetically engineered for tolerance to glyphosate.Fed.Reg.70:36917-19 10. Anim. Plant Health Insp. Serv., USDA. 2007. Introduction of genetically engineered organ- isms: Draft programmatic environmental impact statement-July. http://www.aphis.usda.gov/brs/pdf/ complete_eis.pdf 11. Anim.Plant Health Insp.Serv.,USDA.2007.Return to regulated status of alfalfa genetically engineered for tolerance to the herbicide glyphosate.Fed.Regist.72:56 12. Anim.Plant Health Insp.Serv.,USDA.2008.Control of Russian Knapweed;availability of an environ- mental assessment and finding of no significant impact.Fed.Regist.73:165 13. Anim.Plant Health Insp.Serv.,USDA.2008.Environmental impact statement;determination of regu- lated status of alfalfa genetically engineered for tolerance to the herbicide glyphosate.Fed.Regist.73:4. Docket No.APHIS-2007-0044 www.annualreviews.org • Genetically Engineered Plants and Foods S45 14. Anonymous.2000.Report of seven academies from developing and developed countries.Transgenic Docket 08/00.plants and World agriculture.June 2000.Washington,DC:R.Soc.London,U.S.Natl. Acad.Sci.,Brazilian Acad.Sci.,Chinese Acad.Sci.,Indian Natl.Sci.Acad.,Mexican Acad.Sci.,Third World Acad.Sci. 15. Arpaia S.1996.Ecological impact of Bt-transgenic plants: 1.Assessing possible effects of CryIIIB toxin on honey bee(Apis mellifera L.)colonies.J.Genet.Breed.50:315-19 16. Arriola PE,Ellstrand N. 1996.Crop-to-weed gene flow in the genus Sorghum(Poaceae):spontaneous interspecific hybridization between johnsongrass,Sorghum halepense,and crop sorghum,S.bicolor.Am. J.Bot.83:1153-60 17. Assoc.Off.Seed Certifying Agencies.2008.About AOSCA.http://aosca.org/about.html 18. Atanassov A, Bahieldin A,Brink J,Burachik M, Cohen JI, et al.2004. To reach the poor:Results from the ISNAR-IFPRI Next Harvest study on genetically modified crops,public research, and polity implications. Environ.Prod.Technol.Div.Discuss.Pap.116.Int.Food Policy Res.Inst.,Washington,DC 19.Describes a new 19. Atkinson RC,Beachy RN,Conway G,Cordova FA,Fox MA,et al.2003.Intellectual property paradigm by major U.S. rights:Public sector collaboration for agricultural IP management.Science 301:174-75 agricultural universities 20. Babendreier D,Joller D, Romeis J, Bigler F, Widmer F. 2007. Bacterial community structures in and other public sector honeybee intestines and their response to two insecticidal proteins.FEMS Microbiol.Ecol.59:600-10 101 institutions to manage 21. Babendreier D,Kalberer N,Romeis J,Fluri P,Bigler F.2004.Pollen consumption in honey bee larvae: intellectual property to a step forward in the risk assessment of transgenic plants.Apidologie 35:293-300 facilitate commercial 22. Babendreier D,Kalberer NM,Romeis J,Fluri P,Mulligan E,Bigler F.2005.Influence of Bt-transgenic o development of GE pollen,Bt-toxin and protease inhibitor(SBTI)ingestion on development of the hypopharyngeal glands 3 7 crops. p p in honeybees.Apidologie 36:585-94 E c 23. Babendreier D,Romeis J,Bigler F,Fluri P.2006.Neue Erkenntnisse zu moglichen Auswirkungen von w o transgenem Bt-Mais auf Bienen.Forsch.Agroscope Liebefeld-Posieux ALP Schweiz. 0 0 24. Bailey J,Scott-Dupree C,Harris R,Tolman J,Harris B.2005.Contact and oral toxicity to honey bees c u' (Apis mellifera)of agents registered for use for sweet corn insect control in Ontario,Canada.Apidologie O`^ Ca M 36:623-33 c 25. Bakan B,Melcion D,Richard-Molard D,Cahagnier B.2002.Fungal growth and Fusarium mycotoxin v-�° content in isogenic traditional maize and genetically modified maize grown in France and Spain.J. S Agric.Food Chem.50:728-31 26. Bambawale OM,Singh A,Sharma OP,Bhosle BB,Lavekar RC,et al.2004.Performance of Bt cotton cr o O (MECH-162)under Integrated Pest Management in farmers'participatory field trial in Nanded district, Central India.Curr.Sci.86:1626-33 o N 27. Baiiuelos G,Terry N,LeDuc DL,Pilon-Smits EAH,Mackey B.2005.Field trial of transgenic Indian m T mustard plants shows enhanced phytoremediation of selenium-contaminated sediment. Environ. Sci. Tecbnol.39:1771-77 28. Banuelos GS,Ajwa HA,Mackey M,Wu L,Cook C,et al. 1997.Evaluation of different plant species used for phytoremediation of high soil selenium.J.Environ.Qual.26:639-46 29. Barrioneuvo A.2007.Bees vanish,and scientists race for reasons.The New York Times,April 24 30. Barry G,Kishore G,Padgette S,Taylor M,Kolacz K,et al.1992.Inhibitors of amino acid biosynthesis: strategies for imparting glyphosate tolerance to crop plants.In Biosynthesis and Molecular Regulation of Amino Acids in Plants,ed.BK Singh,HE Flores,JC Shannon,pp.139-45.Madison,WI:Am.Soc.Plant Physiol. 31. Bates SL,Zhao J-Z,Roush RT,Shelton AM.2005.Insect resistance management in GM crops:past, present and future.Nat.Biotechnol.23:57-62 32. Baum JA,Bogaert T,Clinton W,Heck GR,Feldmann P,et al.2007. Control of coleopteran insect pests through RNA interference.Nat.Biotechnol.25:1322-26 33. Bayer CropScience.Liberty Link.2008.htt p://www.bayercropscience.com.au/cs/businessgroups/ LibertyLink.asp 34. Bayne S.2006.Proposals for managing the coexistence of GM,conventional and organic crops.Biologist 53:285-86 35. Beachy RN,Fedoroff NV, Goldberg RB,McHughen A. 2008.The burden of proof:A response to Rosi-Marshall et al.Proc.Natl.Acad.Sci. USA 105:E9 546 Lemaux 36. Becker HC,Damgaard C,Karlsson B.1992.Environmental variation for outcrossing rate in rapeseed (Brassica napus).Theor.Appl.Genet.84:303-6 37. Beckmann V, Soregaroli C, Wesseler J. 2006. Co-existence rules and regulations in the European Union.Am.J.Agric.Econ.88:1193-99 38. Behrens MR,Mutlu N,Chakraborty S,Dumitru R,Jiang WZ,et al.2007.Dicamba resistance:Enlarging and preserving biotechnology-based weed management strategies.Science 316:1185-88 39. Belanger FC,Meagher TR,Day PR,Plumley K,Meyer WA.2003.Interspecific hybridization between Agrostis stolonifera and related Agrostis species under field conditions.Crop Sci.43:240-46 40. Benbrook CM.2004.Impacts of genetically engineered crops on pesticide use in the U.S.:The first nine years. BioTech.InfoNet Tech.Pap. 7.http://www.biotech-info.net/Full_versionStrst_tine.pdf 41. Bennett R,Kambhampati U,Morse S,Ismael Y.2006.Farm-level economic performance of GM cotton in Maharashtra India.Rev.Agric.Econ.28:59-71 42. Bertolla F, Simonet P. 1999.Horizontal gene transfers in the environment:Natural transformation as a putative process for gene transfers between transgenic plants and microorganisms.Res.Microbiol. 150:375-84 3 43. Bhatti MA,Duan J,Head G,Jiang C,McKee MJ,et al.2005.Field evaluation of the impact of corn rootworm(Coleoptera: Chrysomelidae)-protected Bt corn on Foliage-dwelling arthropods.Environ. Entomol.34:1336-45 44. Binenbaum E,Nottenburg C,Pardey PG,Wright BD,Zambrano P.2003.South-North trade,intel- 3 lectual property jurisdictions,and freedom to operate in agricultural research on staple crops.Econ.Dev. 3 °' 3 7 Cult. Change 51:309-55 o45. Biosafety Inf. Cent. 2005. Transgenic trees spread Mercury poisoning. http://www.biosafety-info. o net/article.php?aid=188 c. 46. Bizily SP,Rugh CL,Summers AO,Meagher RB.1999.Phytoremediation of methylmercury pollution: a44 merB expression in Arabidopsis thaliana confers resistance to organomercurials.Proc.Natl.Acad.Sci. USA 96:6808-13 Q cn 47. Bonfim K,Faria JC,Nogueira EOPL,Mendes EA,Aragao FJL.2007.RNAi-mediated resistance to • oBean golden mosaic virus in genetically engineered common bean(Phaseolis vulgaris).Mol.Plant Microbe Interact.20:717-26 M48. Borja M,Rubio T,Scholthof HB,Jackson AO.1999.Restoration of wild-type virus by double recom- bination of tombusvirus mutants with host transgene.Mol.Plant Microbe Interact. 12:153-62 ° 49. Bradford KJ.2007.Methods to maintain genetic purity of seed stocks. Univ.Calif.Agric.Nat.Resourc. ccv Agric.Biotechnol.Calif.Ser.,Publ. 8189 °q 50. Bradford KJ,van Deynze A,Gutterson N,Parrott W,Strauss SH.2005.Regulating transgenic crops sensibly:lessons from plant breeding,biotechnology and genomics.Nat.Biotechnol.23:439-44 a. 51. Brimner TA,Gallivan GJ,Stephenson GR.2004.Influence of herbicide-resistant canola on the envi- ronmental impact of weed management.Pest Manag.Sci.61:47-53 52. Briton K.2006.Methods to enable to coexistence of diverse corn production systems.Univ.Calif.Agric. Nat.Resourc.,Agric.Biotechnol.Calif.Ser.,Publ. 8192 53. Broer I,Droege-Laser W,Gerke M. 1996.Examination of the putative horizontal gene transfer from transgenic plants to Agrobacteria.In Transgenic Organisms and Biosafety,Horizontal Gene Transfer,Stability of DNA and Expression of Transgenes,ed.ER Schmidt,T Hankeln,pp.66-70.Berlin:Springer-Verlag 54. Brookes G,Barfoot P.2006.Global impact of biotech crops:Socio-economic and environmental effects in the first ten years.AgBioForum 9:139-51 55. Brookes G,Barfoot P.2005.GM crops:The global economic and environmental impact-the first nine years 1996-2004.AgBioForum 8:187-96 56. Brookes G,Barfoot P.2006. GM Crops:The First Ten Years-Global Socio-Economic and Environmental Impacts,pp.49-50.Dorchester,UK:PG.Econ. 57. Brown LR,Renner M,Halweil B,eds.2000. Vital Signs 2000.New York:W.W.Norton.191 pp. 58. Brulee-Babel AL. 1997.The evolution of herbicide-resistant weeds.Phytoprotection 78:85-86 59. Byrne PF,Fromherz S.2003.Can GM and Non-GM crops coexist? Setting a precedent in Boulder County,CO.Food Agric.Environ. 1:258-61 www.annualreviews.org • Genetically Engineered Plants and Foods S47 60. Calif. Crop Improv. Assoc. 2007. About the California Crop Improvement Association. http://ccia. ucdavis.edu/html/about-us.htm 61. Carpenter J,Felsot A,Goode T,Hammig M,Onstad D,Sankula S.2002.Comparative environmental impacts of biotechnology-derived and traditional soybean,corn, and cotton crops. Counc.Agric. Sci. Technol. (CAST)June:1-189 62. Carpenter JE, Gianessi LP. 2001. Agricultural Biotechnology: Updated Benefit Estimates, pp. 1-46. Washington, DC: Natl. Cent. Food Agric. Policy. http://www.ncfap.org/documents/ updatedbenefits.pdf 63. Corriere Y,Ellers-Kirk C,Kumar K,Heuberger S,Whitlow M,et al.2005.Long-term evaluation of compliance with refuge requirements for Bt cotton.Pest Manag.Sci.61:327-30 64. Corriere Y,Ellers-Kirk C,Sisterson M,Antilla L,Whitlow M,et al.2003.Long-term regional sup- pression of pink bollworm by Bacillus thuringiensis cotton.Proc.Natl.Acad.Sci. USA 100:1519-23 65. Corriere Y,Sisterson MS,Tabashnik BE.2004.Resistance management for sustainable use of Bacillus thuringiensis crops in integrated pest management.In Insect Pest Management:Field and Protected Crops, ed.AR Horowitz,I Ishaaya,pp.65-95.Berlin:Springer-Verlag 0 66. Cathcart RJ,Topinka AK,Kharbanda P,Lange R,Yang R-C,Hall LM.2006.Rotation length,canola variety and herbicide resistance system affect weed populations and yield. Weed Sci.54:726-34 67. CCD Steer. Comm. 2007. Colony collapse disorder action plan. http://www.ars.usda.gov/is/br/ccd/ ccd_actionplan.pdf c 68. Che D,Meagher RB,Heaton ACP,Lima A,Rugh CL,Merkle SA.2003.Expression of mercuric ion 3 a) reductases in Eastern Cottonwood (Populus deltoides) confers mercuric ion reduction and resistance. Plant Biotechnol..7. 1:311-19 ow 69. Chen LJ,Lee DS,Song ZP,Suh HS,Lu B-R.2004.Gene flow from cultivated rice(Oryza sativa)to o -o its weedy and wild relatives.Ann.Bot.93:67-73 0 0 70. Chitkowski RL, Turnipseed SG, Sullivan MJ, Bridges WC. 2003. Field and laboratory evaluations of transgenic cottons expressing one or two Bacillus thuringiensis var. kurstaki Berliner proteins for o� A n management of noctuid Lepidopter pests./Econ.Entomol.96:755-62 o 71. Chrispeels MJ,Sadava DE. 1994.Plants, Genes and Agriculture.Boston,MA:Jones&Bartlett • ° 72. Comm. Eur. Communities. 2003. Guidelines for the development of national strategies and best practices to ensure the co-existence of genetically modified crops with conventional and organic farming. Brussels, Belg. • „im 75.Summary of gene http://ec.europa.eu/agriculture/publi/reports/coexistence2/index_en.htm o D flow implications of 73. Comm. Intellect. Property Rights. 2002.Integrating intellectual property rights and development policy. ° current commercialized http://www.iprcommission.org/papers/pdfs/final_report/CIPRfullfmal.pdf o N GE crops,how gene 74. Cony.Biol.Divers.2008.Rep.4th Meet.Conf.Parties Cony.Biol.Divers.Meet.Parties Cartagena Protocol i., flow affects adventitious A Biosafety(COP-MOP/4),Bonn,May 12-16 presence and its 75. Counc.Agric.Sci.Technol.(CAST).2007.Implications of gene flow in the scale-up and corn- mitigation,regulatory and risk assessment mercial use of biotechnology-derived crops:Economic and policy considerations.Counc.Agric. approaches,and Sci. Technol.Issue Pap.37.CAST,Ames,IA economic implications. 76. Cox-Foster D.2007.Colony collapse disorder in honey bee colonies in the United States.Testimony to U.S.House Represent.,Agric.Comm.,March 29, Washington,DC 77. Cox-Foster DL,Conlon S,Holmes EC,Palacios G,Evans JD,et al.2007.A Metagenomic survey of microbes in honey bee colony collapse disorder.Science 318:283-87 78. Crop Life Int. 2008. Detection methods in plant biotechnology. http://www.croplife.org/library/ attachments/b5ee05a8-5461-4241-8874-4ecd 1 a53 a3 5 d/3/Detection%20methods%20in% 20Plant%20Biotechnology%20(June%202008).pdf 79. Croughan TP.2003.Clearfield rice:It's not a GMO.La.Agric.46:24-26 80. Croughan TP.2005.Resistance to aminoacetohydroxyacid synthase-inhibiting herbicides.U.S.Patent No.50,198,705 81. Culpepper AS.2006.Glyphosate-induced weed shifts. Weed Technol.20:277-81 82. Culpepper AS, Grey TL,Vencill WK, Kichler JM, Webster TM, et al. 2006. Glyphosate-resistant Palmer amaranth(Amaranthus palmert)confirmed in Georgia. Weed Sci. 54:620-26 83. Cunningham S,Shann J,Crowley D,Anderson T.1997.Phytoremediation of contaminated water and soil. Presented at Phytoremediation Soil Water Contam.,Washington,DC.ACS Symp.Ser.No.664 S48 Lemons 84. D'Hertefeldt T,Jorgensen RB,Pettersson LB.2008.Long-term persistence of GM oilseed rape in the seedbank.Biol.Lett.4:314-17 85. Delmer DP,Nottenburg C,Graff GD,Bennett AB.2003.Intellectual property resources for interna- tional development in agriculture.Plant Physiol. 133:1666-70 86. Dep. Environ. Food Rural Aff. (DEFRA). 2006. Consultation on proposals for managing the co- existence of GM, conventional and organic crops. http://www.defra.govuk/environment/gm/crops/ pdf/gmcoexist-condoc.pdf 87. Dep.Environ.Food Rural Aff.(DEFRA).2007.Environmental protection genetic modification 87.Describes final (GM)farm scale evaluations.http://www.defra.gov.uk/environment/gm/fse/ results of largest 88. DiFonzo C.2002. Status of transgenic rootworm-protected corn.Field Crop Advisory Team Alert 17 farm-scale evaluation of (No.2) environmental impact 89. Douville M,Gagne F,Blaise C,Andre C.2007.Occurrence and persistence of Bacillus thuringiensis(Bt) of herbicide-tolerant GE crops. and transgenic Bt corn crylAb gene from an aquatic environment.Ecotoxicol.Environ.Saf.66:195-203 90. Droge M,Puehler A, Selbitschka W. 1998. Horizontal gene transfer as a biosafety issue: A natural cu o phenomenon of public concern.y.Biotechnol.64:75-90 91. Duan JJ,Marvier M,Huesing J,Dively G,Huang ZY.2008.A meta-analysis of effects of Bt crops on honey bees(Hymenoptera:Apidae).PLoS ONE 3:e1415 92. Durham S.2005.United States-Brazil collaboration heats up.Agric.Res. 53:14-15 93. Deleted in proof 0 94. Edmeades S,Smale M.2006.A trait-based model of the potential demand for a genetically engineered °' food crop in a developing economy.Agric.Econ.35:351-61 3 � 95. Ellstrand NC.2001.When transgenes wander,should we worry?Plant Physiol. 125:1543-45 w ° 96. Ellstrand NC.2003.Dangerous Liaisons?When Cultivated Plants Mate with their Wild Relatives. 96.Classic and current -o i aknowledge about crop a Baltimore,MD:Johns Hopkins Univ.Press u°, 97. Ellstrand NC.2006.Genetic engineering and pollen flow. Univ. Calif Div.Agric.Nat.Resourc.Agric. genetics,hybridization, o Biotechnol.Calif Ser.Publ.8182. and evolutionary Ca 98. Ellsworth PC,Jones JS.2001.Cotton IPM in Arizona:A Decade of Research,Implementation and Education, ecology with regard to N gene flow and o ed.J Silvertooth,pp. 199-214.Tucson:Univ.Ariz.,Coll.Agric.Life Sci. hybridization between 0 99. Elmegaard N, Bruus Pedersen M. 2001.Flora and Fauna in roundup tolerant fodder beet fields. Natl. crops(including GE) sr) Environ. Res. Inst. Tech. Rep. No. 349. 40 pp. http://www.dmu.dk/1_viden/2.Publikationer/ and native species. ■ 4 3..agrapporter/rapporter/FR349.pdf - - °i 100. Engels JMM,Ebert AW,Thormann I,de Vicente MC.2006.Centres of crop diversity and/or origin, o N genetically modified crops and implications for plant genetic resources conservation.Genet.Resour.Crop °a p Evol.53:1675-88 101. Ennos RA.1997.The influence of agriculture on genetic biodiversity.Presented at Biodivers.Conserv.Agric. Br.Crop Prot.Counc.Symp.Proc.69.Surrey,UK 102. Environ. Prot. Agency (EPA). 2000. Bt plant pesticides biopesticides registration action document. http://www.epa.gov/oscpmont/sap/meetings/2000/october/brad3_enviroassessment.pdf 103. Environ.Prot.Agency(EPA).2007.Insect resistance management fact sheet for Bacillus thuringiensis (Bt)corn products.http://wwwepa.gov/oppbppd1/biopesticides/pips/bt_corn_refuge2006.htm 104. Environ. Prot. Agency (EPA). 2008. Integrated pest management (IPM) principles. http://www. epa.gov/opp00001/factsheets/ipm.htm 105. Eur. Comm. 2007. United States barriers to trade and investment for 2006. Feb. 2007. http://trade. ec.europa.eu/doclib/docs/2007/february/tradoc_13 3 290.pdf 106. Faria CA,Wackers FL,Pritchard J,Barrett DA,Turlings TCJ.2007.High susceptibility of Bt maize to aphids enhances the performance of parasitoids of lepidopteran pests.PLoS ONE 2:e600 107. Federici B. 2002. Case study: Bt crops a novel mode of insect control.In Genetically Modified Crops: Assessing Safety,ed.KT Atherton,pp. 164-200.London:Taylor&Francis 108. Fernandez-Cornejo J,Caswell M.2006.The first decade of genetically engineered crops in the United States. USDA Econ.Res.Serv.,Econ.Inf.Bull.No.11.http://www.ers.usda.gov/publications/eib11/eib11.pdf 109. Fernandez-Cornejo J,McBride WD.2002.Adoption of bioengineered crops. USDA Econ.Res.Serv.,Agric. Econ.Rep.No.810.http://www.ers.usda.gov/publications/aer810/ www.annualreviews.org • Genetically Engineered Plants and Foods 549 110. Fernandez-Cornejo J, Schimmelpfennig D. 2004. Have seed industry changes affected re- search effort? Amber Waves, Feb. 2004. http://www.ers.usda.gov/amberwaves/February04/ Features/HaveSeed.htm 111. Ferre J,Van Rie J.2002.Biochemistry and genetics of insect resistance to Bacillus thuringiensis.Annu. Rev.Entomol.47:501-33 112. Firbank LG,Forcella F.2000.Genetically modified crops and farmland biodiversity.Science 289:1481- 82 113. Fondong VN,Pita JS,Rey MEC,de Kochko A,Beachy RN,Fauquet CM.2000.Evidence of synergism between African cassava mosaic virus and a new double-recombinant geminivirus infecting cassava in Cameroon.J.Gen. Viral.81:287-97 114. Food Agric. Org. (FAO). 2008. Hunger on the rise. http://www.fao.org/newsroom/en/news/2008/ 1000923/index.html 115. Fowler C.1994.Unnatural Selection:Technology,Politics and Plant Evolution.Yverdon,Switz.:Gordon& Breach Sci. 116. Frankel OH.1970.Genetic conservation in perspective.In Genetic Resources in Plants-Their Exploration and Conservation,ed.OH Frankel,E Bennett,pp.469-89.Oxford:Blackwell 117. Fraser C,Hanage WP,Spratt BG.2007.Recombination and the nature of bacterial speciation.Science 315:476-80 118. Frischmuth T, Stanley J. 1998. Recombination between viral DNA and the transgenic coat protein o gene of African cassava mosaic geminivirus.J.Gen. Virol.79:1265-71 3 , 119. Fuchs M,Gonsalves D.1995.Resistance of transgenic hybrid squash ZW-20 expressing the coat protein ` genes of zucchini yellow mosaic virus and watermelon mosaic virus 2 to mixed infections by both w o potyviruses.Bio/Technology 13:1466-73 a 120. Fuglie KO,Heisey PW.2007.Economic returns to public agricultural research.USDA Econ.Res.Seru., oa Agric.Econ.Brief No.10 121. Gahan LJ,Gould F,Heckel DG.2001.Identification of a gene associated with Bt resistance in Heliothis A M virescens.Science 293:857-60 122. Gardner SN, Gressel J,Mangel M. 1998. A revolving dose strategy to delay the evolution of both trl ° quantitative vs major monogene resistances to pesticides and drugs.Int.J.Pest Manag.44:161-80 123. Gate2Biotech.2008.Economy of transgenic crops evaluated.http://www.gate2biotech.com/economy- M of-transgenic-crops-evaluated/ o124. Gatehouse JA.2008.Biotechnological prospects for engineering insect-resistant plants.Plant Physiol. 146:881-87 o 7. 125. Gebhard F,Smalla K.1998.Transformation of Acinetobacter sp.BD413 by transgenic sugar beet DNA. T -g Appl.Environ.Microbiol.64:1550-54 126. Gebhard F,Smalla K.1999.Monitoring field releases of genetically modified sugar beets for persistence of transgenic plant DNA and horizontal gene transfer.FEMS Microbiol.Ecol.28:261-72 127. Glazer AN,Nikaido H. 1995.Microbial Biotechnology:Fundamentals of Applied Microbiology.New York: W.H.Freeman 128. GMO Saf. 2005. E ects of Bt maize pollen on the honeybee. h //www o-safe eu/en/safe }f f P y ttP� gn' ty. ty_ science/68.docu.html 129. GMO Saf. 2006. Coexistence in the countries of the EU: A European patchwork. http://www.gmo- safety.eu/en/coexistence/513.docu.html 130. GMO Saf.2006.Coexistence to continue to be regulated by member states for the time being.http://www.gmo- safety.eu/en/news/346.docu.html 131. GMO Saf.2008.Coexistence information system.http://www.gmo-safety.eu/en/coexistence/db/ 132. Gold MV. 1999. Sustainable agriculture: Definitions and terms. Spec. Ref Briefs Ser No. SRB 99-02. http://www.nal.usda.gov/afsic/pubs/terms/srb9902.shtml 133. Gomez-Barbero M,Berbel J,Rodriguez-Cerezo E.2008.Bt corn in Spain-the performance of the EU's first GM crop.Nat.Biotechnol.26:384-86 134. Gomez-Barbero M, Rodriguez-Cerezo E. 2006. Economic impact of dominant GM crops World- wide: A Review. Eur. Comm. DG JRC-IPTS. EUR 22547 EN http://www.eurosfaire.prd.fr/ 7pc/doc/1172656607ipts_ogm_eur22547en.pdf 550 Lemaux 135. Goto F,Yoshihara T, Shigemoto N,Told S,Takaiwa F. 1999. Iron fortification of rice seed by the soybean ferritin gene.Nat.Biotechnol. 17:282-86 136. Gould F.1998.Sustainability of transgenic insecticidal cultivars,integrating pest genetics and ecology. Annu.Rev.Entomol.43:701-26 137. Gouse M,Pray C,Kirsten J,Schimmelpfenning D.2005.A GM subsistence crop in Africa:the case of Bt white maize in South Africa.Int.J.Biotechnol.7:84-94 138. Graff GD,Cullen SE,Bradford KJ,Zilberman D,Bennett AB.2003.The public-private structure of intellectual property ownership in agricultural biotechnology.Nat.Biotechnol.21:989-95 139. Grainnet.2007.Monsanto and Dow Agrosciences launch"SmartStax",industry's first-ever eight-gene stacked combination in corn.Sept.14.http://www.grainnet.com 140. Greene AE,Allison RF. 1994. Recombination between viral RNA and transgenic plant transcripts. Science 263:1423-25 141. Gressel J,Segel L,Ransom JK.1996.Managing the delay of evolution of herbicide resistance in parasitic weeds.Int.5.Pest Manag.42:113-29 an 142. Gressel J,Segel L, Ransom JK. 1999.Tandem constructs:Preventing the rise of superweeds. Trends Biotechnol. 17:361-66 143. Gruber S,Pekrun C,Claupein W.2004.Population dynamics of volunteer oilseed rape(Brassica napes L.)affected by tillage.Eur.J.Agron.20:351-61 144. Gupta PK.1998.The terminator technology for seed production and protection:Why and how?Cun: o Sci.75:1319-23 • ;• ' 145. Halfhill MD,Milwood RJ,Raymer PL,Stewart CN Jr.2002.Bt-transgenic oilseed rape hybridization o G with its weedy relative,Brassica raga.Environ.Biosaf Res. 1:19-28 • o 146. Hall L,Topinka K,Huffman J,Davis L,Good A,Allen A.2000.Pollen flow between herbicide-resistant a Brassica nap us is the cause of multiple-resistant B-napus volunteers. Weed Sci.48:688-94 o c ° 147. Hennen S, Scursoni J,Forcella F,Gunsolus J.2002.Delayed weed emergence and escape from control in glyphosate-tolerant soybean.Presented at North Cent.Weed Sci.Soc.Abstr.57:126 148. Heuberger S, Ellers-Kirk C, Yafuso C, Gassmann AJ, Tabashnik BE, et al. 2008. Effects of refuge o contamination by transgenes on Bt resistance in pink bollworm(Lepidoptera: Gelechiidae).5. Econ. • g Entomol. 101:504-14 cn 149. Horrigan L,Lawrence RS,Walker P.2002.How sustainable agriculture can address the environmental o:'4 and human health harms of industrial agriculture.Environ.Health Perspect. 110:445-56 o 150. Huang J,Hu R,Rozelle S,Pray C.2005.Insect-resistant GM rice in farmers'fields:Assessing produc- t N tivity and health effects in China.Science 308:688-90 151. Huang J,Rozelle S,Pray C,Wang Q.2002.Plant biotechnology in China.Science 295:674-76 152. Husken A,Dietz-Pfeilstetter A.2008.Parameters affecting gene flow in oilseed rape.ISB News Rep. March:1-4 153. Hutmacher RB,Vargas RN,Wright SD.2006.Methods to enable coexistence of diverse production systems involving genetically engineered cotton.Univ.Calif.Agric.Natl.Resour.,Agric.Biotechnol.Calif. Ser.,Publ.8191 154. Icoz I,Saxena D,Andow DA,Zwahlen C,Stotzky G.2008.Microbial populations and enzyme activities in soil in situ under transgenic corn expressing cry proteins from Bacillus thuringiensis.J.Environ.Qual. 3 7:647-62 155. Inspector Gen.USDA.2005.Audit Report:Animal and Plant Health Inspection Service Controls over Issuance of Genetically Engineered Organism Release Permits.Audit 50601-8-Te 156. Int. Seed Fed.2004. Coexistence of genetically modified conventional and organic crop production,pp. 1-3. http://www.worldseed.org/cros/medias/file/PositionPapers/OnSpecificTechnicalSubj ects/ Coexistence_of_Genetically..Modified_Conventional_and_Organic_Crop_Production20040526_ (En).pdf 157. ISB (Inf. Syst. Biotechnol.). 1995. Genetically engineered virus resistant squash approved for sale.NBIAP News Rep.,Jan.http://wvvw.isb.vt.edu/news/1995/news95.Jan.txt 158. ISB(Inf.Syst.Biotechnol.).2007.Field Test Release Applications in the U.S. (Database provided by APHIS Biotechnology Regulatory Services).http://www.isb.vt.edu/CFDOCS/fieldtests1.cfm www.annualreviews.org • Genetically Engineered Plants and Foods 551 t. 159. ISB(Inf.Syst.Biotechnol.)2007.Petitions ofnonregulated status granted or pending by APHIS.http://www. aphis.usda.gov/brs/not_reg.html 160. ISB (Inf. Syst. Biotechnol.). 2007.Results of search: Crops no longer regulated by USDA. http://www. isb.vt.edu/cfdocs/biopetitions3.cfm 161. ISB(Inf.Syst.Biotechnol.).2008.PetitimuofnonregulatedstatusgrantedorpendingbyAPHIS.http://www. aphis.usda.gov/brs/not_reg.html 162. Ishikawa H, Hoshino Y,Motoki Y,Kawahara T,Kitajima M, et al. 2007.A system for the directed evolution of the insecticidal protein from Bacillus thuringiensis.Mol.Biotechnol.36:90-101 163. Itoh K.2000.Occurrence ofsulfonylurea resistant paddy weeds and their control.J.Pestic.Sci.25:281-84 164. James C.2006.Global status of commercialized biotech/GM crops:2006.ISAAA Briefs No.35 165.Comprehensive 165. James C.2007.Global status of commercialized biotech/GM crops:2007.ISAAA Briefs No.37 review of current status 166. Janmaat AF, Myers JH. 2003. Rapid evolution and the cost of resistance to Bacillus thuringiensis in of acreage of genetically greenhouse populations of cabbage loopers,Trichoplusia ni.Proc.R.Soc.Ser.B 270:2263-70 engineered crops grown 167. Jany K-D.2007.Genetically modified plants and bees.http://www.europabio.org/GBEmedia/Bees% worldwide. 20%20transgenic%20plants-£doc 168. Jimenez Juarez A,Munoz-Garay C,Gomez I,Saab-Rincon G,Damian-Alamazo JY,et al.2007.Bacillus .>2 thuringiensis CrylAb mutants affecting oligomer formation are non-toxic to Manduca sexta larvae.J.Biol. Chem.282:21222-29 169. Jones P.2007.Federal courts disapprove APHIS approval procedures.ISB News Rep.April:4-6 ca o° 170. Kalaitzandonakes N,Alston JM,Bradford KJ.2007.Compliance costs for regulatory approval of new 3 ,, biotech crops.Nat.Biotechnol.25:509-11 • ' 171. Kershen DL.2004.Legal Liability issues in agricultural biotechnology.Crop Sci.44:456-63 i~ro o 172. Kershen DL,McHughen A. 2005.Adventitious presence:Inadvertent commingling and coexistence Ti among farming methods.CAST Comment.QTA2005-1,July 0 0 173. Kleter GA,Bhula R,Bodnaruk K,Carazo E,Felsot AS,et al.2008.Trends in pesticide use on transgenic versus conventional crops.Inf.Syst.Biotechnol.Aug.2008:5-7 o� Cam 174. Kleter GA,Bhula R,Bodnaruk K,Carazo E,Felsot AS,et al.2007.Altered pesticide use on transgenic crops and the associated general impact from an environmental perspective.Pest Manag.Sci.63:1107-15 ?° - - 175. Kleter GA, Harris C, Stephenson G, Unsworth J. 2008. Comparison of herbicide regimes and the a M 178.Presents a method, associated potential environmental effects of glyphosate-resistant crops vs.what they replace in Europe. o"' termed the %.o cn Pest Manag.Sci.64:479-88 `D environmental impact p 176. Kling J.1996.Could transgenic supercrops one day breed superweeds?Science 274:180-81 ° quotient,to calculate 177. Knox OGG,Constable GA,Pyke G,Gupta VVSR.2006.Environmental impact of conventional and N the environmental as T impact of pesticides Bt insecticidal cotton expressing one and two Cry genes in Australia.Aust.J.Agric.Res.57:501-9 used in commercial 178. Kovach JA,Petzoldt C, Degni J,Tette J. 1992.A method to measure the environmental impact agriculture to facilitate of pesticides. N.Y.Food Life Sci. Bull. 139.NYS Agric. Exp. Stn., Cornell Univ., Geneva, NY. comparison of different http://www.nysipm.cornell.edu/publications/eiq/default.asp • pesticides and pest 179. Kovach JA, Petzoldt C, Degni J, Tette J. 2003. Method to measure environmental im- Q management practices. pacts of pesticides. NY State Integr. Pest Manag. Manual. http://www.nysipm.cornell.edu/ publications/eiq/files/EIQ_values04.pdf 180. Kryder RD, Kowalski SP, Krattiger AF. 2000.The intellectual and technical property components of pro-vitamin a rice(Golden RiceTM):A preliminary freedom-to-operate review.ISAAA Briefs No. 20-2000 181. Ku MSB,Agarie S,Nomura M,Fukayama H,Tsuchida H,et al. 1999.High-level expression of maize phosphoenolpyruvate carboxylase in transgenic rice plants.Nat.Biotechnol. 17:76-80 182. Lauer J,Wedberg J.1999.Grain yield of initial Bt corn hybrid introductions to farmers in the Northern Corn Belt.J.Prod.Agric. 12:373-76 183. LeDuc DL,AbdelSamie M,Montes-Bayon M,Wu CP,Reisinger SJ,Terry N.2006.Overexpressing both ATP sulfurylase and selenocysteine methyltransferase enhances selenium phytoremediation traits in Indian mustard.Environ.Pollut. 144:70-76 184. LeDuc DL,Tarun AS,Montes-Bayon M,Meija J,Malit MF,et al.2004.Overexpression of selenocys- teine methyltransferase in Arabidopsis and Indian Mustard increases selenium tolerance and accumula- tion.Plant Physiol. 135:377-83 552 Lemaux • 185. Lee LJ,Ngim J.2000.A first report of glyphosate-resistant goosegrass(Eleusine indica(L)Gaertn)in Malaysia.Pest Manag.Sci.56:336-39 186. Lemaux PG.2006.Ag Biotech Pipeline.What's in the Lineup?Eaglesham A,Hardy R.Agricultural Biotech- nology: Economic Growth through New Products, Partnerships and Workforce Development. Natl. Agric. Biotechnol.Counc.Rep. 18,pp.31-43.Ithaca,NY 186a. Lemaux PG.2008.Genetically engineered plants and foods:a scientist's analysis of the issues(Part I). Annu.Rev.Plant Biol.59:771-812 187. Li YX,Greenberg SM,Liu TX.2006.Effects of Bt cotton expressing Crylac and Cry2ab and non-Bt cotton on behavior,survival and development of Trichoplusia ni(Lepidoptera:Noctuidae). Crop Prot. 25:940-48 188. Lindbo JA,Dougherty WG.2005.Plant pathology and RNAi:A brief history.Annu.Rev.Phytopathol. 43:191-204 189. Lius S,Manshardt RM,Fitch MAIM,Slightom JL,Sanford JC,Gonsalves D.1997.Pathogen-derived resistance provides papaya with effective protection against papaya ringspot virus.Mol.Breed.3:161-68 190. Llewellyn DJ,Mares CL,Fitt GP.2007.Field performance and seasonal changes in the efficacy against Helicoverpa armigera(Hubner)of transgenic cotton expressing the insecticidal protein Vip3A.Agric.For. Entomol.9:93-101 191. LoseyJE,Rayor LS,Carter ME. 1999.Transgenic pollen harms monarch larvae.Nature 399:214 192. Luttrell RG,Wan L,Knighten K. 1999.Variation in susceptibility of Noctuid(Lepidoptera)larvae 3 o attacking cotton and soybean to purified endotoxin proteins and commercial formulations of Bacillus 3 o thuringiensis.J.Econ.Entomol.92:21-32 ° 193. Mallet J,Porter P. 1992.Preventing insect adaptation to insect-resistant crops: are seed mixtures or o o refugia the best strategy?Proc.R.Soc.B 250:165-69 o E 194. Mallory-Smith C,Zapiola M.2008.Gene flow from glyphosate-resistant crops.Pest Manag.Sci.64:428- 0 40 195. Mao Y-B,Cai W J,Wang J-W,Hong G J,Tao Y-Y, et al.2007. Silencing a cotton bollworm P450 3 r; monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol.Nat. Biotechnol. 25:1307-13 ° 196. Marchant MA,Fang C,Song B.2002.Issues on adoption,import regulations and policies for biotech v,M commodities in China with a focus on soybeans.AgBioForum 5:167-74 cn c,; 197. Marvier M,Carriere Y,Ellstrand N,Gepts P,Kareiva P,et al.2008.Harvesting data from genetically engineered crops.Science 320:452-53 -- 198. Marvier M,McCreedy C,Regetz J,Kareiva J.2007.A Meta-analysis of effects of Bt cotton and 198.Creates a ° 7 co'" maize on nontarget invertebrates.Science 316:1475-77 searchable database for n 199. Masuta C,Ueda S,Suzuki M,Uyeda I. 1998.Evolution of a quadripartite hybrid virus by interspecific nontarget effects of Bt exchange and recombination between replicase components of two related tripartite RNA viruses.Proc. crops plus results of Natl.Acad.Sci. USA 95:10487-92 meta-analysis of 42 field 200. Matten SR, Head GP, Quemada HD. 2008 How governmental regulation can help or hinder the experiments on nontarget invertebrates. integration of Bt crops within IPM programs.In Integration of Insect-Resistant Genetically Modified Crops within IPM Programs,ed.J Romeis,AM Shelton,GG Kennedy,pp.27-39.New York:Springer 201. McHughen A.2006.Plant Genetic Engineering and Regulation in the U.S. Univ.Calif.Agric.Nat.Resourc. Agric.Biotechnol.Calif.Ser.Publ. 8179 202. Migus M. 2004. GMO Statutory liability regimes:An international review. Can. Inst. Environ. Law Policy,Dec. 203. Mikkelsen TR,Jensen J,Jorgensen RB.1996.Inheritance of oilseed rape(Brassica napus)RAPD markers in a backcross progeny with Brassica campestris.Theor.Appl.Genet.92:492-97 204. Millenn.Ecosyst.Assess.2005.Ecosystems and Human Well-Being:Synthesis.Washington, DC: Island Press 205. Millman S. 1990.Hunger in the 1980s:Backdrop for policy in the 1990s.Food Policy 15:277-85 206. Mitchell P,Alston J,Hyde J,Marra M.2003.Benefits from transgenic maize resistant to corn rootworm. ISB News Rep.Oct.:8-9 207. Monarch Watch.2007.Monarch Watch Email Updates.http://www.monarchwatch.org/update/index. html www.annualreviews.org • Genetically Engineered Plants and Foods 553 • 208. Monsanto.2005.Pledge Report.http://www.monsanto.com/pdf/pubs/2005/focusimpacts.pdf 209. Morin S,Biggs RW,Sisterson MS,Shriver L,Ellers-Kirk C,et al.2003.Three cadherin alleles associated with resistance to Bacillus thuringiensis in pink bollworm.Proc.Natl.Acad.Sci. USA 100:5004-9 210. Morse S,Bennett RM,Ismael Y.2005.Bt-cotton boosts the gross margin of small-scale cotton producers in South Africa.Int..7.Biotechnol.7:72-83 211. Morse S,Bennett RM,Ismael Y.2005.Genetically modified insect resistance in cotton:some farm level economic impacts in India.Crop Prot.24:433-40 212. Morton RL,Schroeder HE,Bateman KS,Chrispeels MJ,Armstrong E,Higgins TJV.2000.Bean ct- amylast inhibitor 1 in transgenic peas(Pisum sativum)provides complete protection from pea weevil (Bruchus pisorum)under field conditions.Proc.Natl.Acad.Sci. USA 97:3820-25 213. Mowery DC,Nelson RR,Sampat BN,Ziedonis AA.2001.The growth of patenting and licensing by U.S.universities:an assessment of the effects of the Bayh-Dole act of 1980.Res.Policy 30:99-119 214. Nabhan GP. 2000. Native American management and conservation of biodiversity in the Sonoran Desert Bioregion:An ethnoecological perspective.In Biodiversity and Native America,ed.PE Minnis, an WJ Elisens,pp.29-43.Norman:Univ.Oklahoma Press ° 215. Naimov S, Dukiandjiev S, de Maagd RA. 2003.A hybrid Bacillus thuringiensis delta-endotoxin gives resistance against a coleopteran and a lepidopteran pest in transgenic potato.Plant Biotechnol.J. 1:51-57 216. Nandula VK,Reddy KN,Duke SO,Poston DH.2005.Glyphosate-resistant weeds:Current status and future outlook.Outlooks Pest Manag.Aug.:183-87 217. Natl.Cent.Ecol.Anal.Synth.2008.Nontarget effects of Bt crops.http://delphi.nceas.ucsb.edu/btcrops 3 218. Natl. Corn Growers Assoc. 2005. Corn growers maintained high levels of IRM adherence in 2004. 3 ;' http://www.ncga.com/news/releases/2005Qanuary/news010605.htm G 219. Natl. Corn Growers Assoc. 2008. Approval status of Biotech Corn Hybrids. Sept. http://www. prnewswire.com/cgi-bin/stories.pl?ACCT=109&STORY=/www/story/01-06-2005/ 8 8 0002773607&EDATE= c w 220. Natl. Org. Program (NOP). 2006. Applicability-Preamble. http://www.ams.usda.gov/nop/nop/ oc.; Ga n, standards/applicpre.html 221. Nail. Org. Program (NOP). 2006. NOP regulations and guidelines. http://www.ams.usda.gov/ ° nop/NOP/NOPhome.html a ,n 222. Natl. Org. Program(NOP). 2008.National list of allowed and prohibited substances. http://www.ams. usda.gov/AMSv1.0/ams.fetchTemplateData.do?template=TemplateN&navID= o NationalListLinkNOPNationalOrganicProgramHome&rightNavl= NationalListLinkNOPNationalOrganicProgramHome&topNav=&leftNav= NationalOrganicProgram&page=NOPNationalList&resultType=&acct=nopgeninfo aa� . 223. Nail.Org.Program(NOP).2008.National Organic Program.http://www.ams.usda.gov/nop 224. Nail. Org. Program (NOP). 2008. Sect. 205.105. http://ecfr.gpoaccess.gov/cgi/t/text/text- ': idx?c=ecfr;sid=11fd57b422b6314d866dc4b02fla101d;rgn=div5;view=text;node=7:3.1.1.9.30; x idno=7;cc=ecfr#7:3.1.1.9.30.2.336.6 225. Deleted in proof 226. Nielsen KM,Gebhard F,Smalla K,Bones AM,van Elsas JD. 1997.Evaluation of possible horizontal gene transfer from transgenic plants to the soil bacterium Acinetobacter calcoaceticus BD413.Theor.Appl. Genet.95:815-21 227. Nielsen KM, van Elsas JD, Smalla K. 2000. Transformation of Acinetobacter sp. strain BD413(pFG4AnptII) with transgenic plant DNA in soil microcosms and effects of Kanamycin on selection of transformants.Appl.Environ.Microbiol.66:1237-42 228. N.C. State Univ. Biol. Control Inf. Cent. 2008. Biological pest control:An introduction. http://cipm. ncsu.edu/ent/biocontrol/intro.htm 229. Off.Sci.Technol. 1984.Proposal for a coordinated framework for regulation of biotechnology.Fed. Begirt.49:50 230. Oliver MJ,Quisenberry JE,Trolinder NLG,Keim DL. 1998.Control of plant gene expression. U.S. Patent 5723765 231. Paarlberg RL.2002.The real threat to GM crops in poor countries:consumer and policy resistance to GM foods in rich countries.Food Policy 27:247-50 554 Lemaux • 232. Parrott W.2008.Study of Bt impact on caddisflies overstates its conclusions:Response to Rosi-Marshall et al.Proc.Natl.Acad.Sci. USA 105:E10 233. Pew Initiat. Food Biotechnol. 2006.Peaceful Coexistence Among Growers of Genetically Engi- 233.Summary of workshop examining veered, Conventional and Organic Crops. The Natl.Assoc.State Dep.Agric. The Pew Initiat.Food how growers of Biotechnol.Boulder,CO.http://pewagbiotech.org/events/0301/WorkshopReport.pdf conventional,GE,and 234. Pidgeon JD,May MJ,Perry JN,Poppy GM.2007.Mitigation of indirect environmental effects of GM organic crops peacefully crops.Proc.R.Soc.B 274:1475-79 coexist and identified 235. Pieper DH,Reineke W.2000.Engineering bacteria for bioremediation.Curr.Opin.Biotechnol. 11:262- options on how to foster 70 coexistence. 236. Pigott CR,Ellar DJ.2007.Role of receptors in Bacillus thuringiensis crystal toxin activity.Microbiol.Mol. Biol.Rev.71:255-81 237. Pimentel DS,Raven PH.2000.Bt corn pollen impacts on nontarget Lepidoptera:Assessment of effects in nature.Proc.Natl.Acad.Sci. USA 97:8109-99 238. PIPRA.2008.The Public Intellectual Property Resource for Agriculture.http://www.pipra.org °0 239. Pleasants JM,Hellmich RL,Dively GP,Sears MK,Stanley-Horn DE,et al.2001.Corn pollen depo- 0 sition on milkweeds in and near cornfields.Proc.Natl.Acad.Sci. USA 98:11919-24 240. Pratley J,Urwin N, Stanton R, Baines P,Broster J, et al. 1999. Resistance to glyphosate in Lolium rigidum.I.Bioevaluation.Weed Sci.47:405-11 • 241. Prescott VE,Campbell PM,Moore A,Mattes J,Rothenberg ME,et al.2005.Transgenic expression of o bean a-amylase inhibitor in peas results in altered structure and immunogenicity. Agric.Food Chem. 3 0 53:9023-30 ° 242. Preston C, Boutsalis P. 2008. Another pesticide resistant weed found. Weeds CRC. http://www. o sciencealert.com.au/news/20082608-17859-2.htnil a243. Purdue Univ. 2004. New Purdue Web site delves into Indiana's horseweed issue. http://news.uns. 8 8 purdue.edu/html3month/2004/041210.Johnson.weed.huld 244. Putnam DH.2006.Methods to enable coexistence of diverse production systems involving genetically 3r o engineered alfalfa. Univ.Calif Agric.Nat.Resourc.,Agric.Biotechnol. Calif Ser,Publ. 8193 245. Qaim M,Trailer G.2005.Roundup Ready soybeans in Argentina: farm level and aggregate welfare 5° effects.Agric.Econ.43:73-86 v r, 246. Qaim M,Zilberman D.2003.Yield effects of genetically modified crops in developing countries.Science • m 299:900-2 o 247. Ramirez-Romero R,Chaufaux J,Pham-Delegue MH.2005.Effects of CrylAb protoxin,deltamethrin and imidacloprid on the foraging activity and the learning performances of the honeybee Apis mellifera, a comparative approach.Apidologie�-' P PP P� BY e 36:601-11 a 248. Rao KV,Rathore KS,Hodges TK,Fu X,Stoger E,et al. 1998.Expression of snowdrop lectin(GNA) in transgenic rice plants confers resistance to rice brown planthopper.Plant 1. 15:469-77 ago' 249. Reichman JR,Watrud LS.2007.Identification of escaped transgenic creeping Bentgrass in Oregon. ISB News Rep.,April:1-4 250. Reichman JR, Watrud LS, Lee EH, Burdick C, Bollman MA, et al. 2006. Establishment of trans- genic herbicide-resistant creeping bentgrass(Agrostis stolonifera L.)in nonagronomic habitats.Mol.Ecol. 15:4243-55 251. Rivero RM, Kojima M, Gepstein A, Sakakibara H,Mittler R, et al. 2007. Delayed leaf senescence induces extreme drought tolerance in a flowering plant.Proc.Natl.Acad.Sci. USA 104:19631-36 252. Ronald P,Fouche B. 2006.Genetic engineering and organic production systems. Univ. Calif.Agric. Nat.Resour.,Agric.Biotechnol.Calif.Ser.,Publ.8188 253. Ronald PC,Adamchak RW.2008. Tomorrow's Table. Organic Farming, Genetics and the Future of Food. New York:Oxford Univ.Press 254. Roush RT.1998.Two toxin strategies for management of insecticidal transgenic crops:Can pyramiding succeed where pesticide mixtures have not?Philos.Trans.R.Soc.London Ser.B 353:1777-86 255. Rubio T,Borja M,Scholthof HB,Jackson AO. 1999.Recombination with host transgenes and effects on virus evolution:An overview and opinion.Mol.Plant Microbe Interact. 12:87-92 256. Rural Adv. Found. Int. 1999. RAFI's Impact: 1999. Insert to 1998/99 RAFI Annual Report. www.etcgroup.org/upload/report/12/01/99rafiimpact.pdf www.annualreviews.org • Genetically Engineered Plants and Foods 555 257. Salt DE,Pickering IJ,Prince RC,Gleba D,Dushenkov S,et al. 1997.Metal accumulation by aquacul- tured seedlings of Indian mustard.Environ.Sci.Technol. 31:1636-44 258. Sankula S, Blumenthal E. 2004. Impacts on US Agriculture of Biotechnology-Derived Crops Planted in 2003 An Update of Eleven Case Studies. Natl. Cent. Food Agric. Policy. http://croplife. intraspin.com/Biotech/papers/80%202004finalreport.pdf 259. Sankula S, Marmon G, Blumenthal E. 2005. Biotechnology-Derived Crops Planted in 2004- Impacts on US Agriculture. Natl. Cent. Food Agric. Policy. http://www.whybiotech.com/ resources/tps/BiotechnologyDerivedCropsPlantedin2004.pdf 260. Schlueter K,Fuetterer J,Potrykus I.1995."Horizontal"gene transfer from a transgenic potato line to a bacterial pathogen(Erwinia chrysanthemz)occurs-if at all-at an extremely low frequency.Bio/Technology 13:1094-98 261. Schnepf E, Crickmore N,Van Rie J, Lereclus D, Baum J, et al. 1998. Bacillus thuringiensis and its pesticidal crystal proteins.Microbiol.Mol.Biol.Rev.62:775-806 262. Schoelz JE,Wintermantel WM. 1993.Expansion of viral host range through complementation and en recombination in transgenic plants.Plant Cell 5:1669-79 263. Scursoni JA,Forcella F,Gunsolus J.2007.Weed escapes and delayed weed emergence in glyphosate- resistant soybean.Crop Prot.26:212-18 264.Describes five 264. Sears MK,Hellmich RL,Stanley-Horn DE,Oberhauser KS,Pleasants JM,et al.2001.Impact c independent field of Bt corn pollen on monarch butterfly populations:A risk assessment. Proc. Natl.Acad. Sci. 8 studies-commissioned USA 98:12326-30 3 o to investigate findings 265. Seki M,Umezawa T,Urano K,Shinozaki K.2007. Regulatory metabolic networks in drought stress 3 ° reported by Losey et al. o 7,4 responses.Curr.Opin.Plant Biol. 10:296-302 o (1999)-to determine 266. Service RF.1998.Seed-sterilizing`terminator technology'sows discord.Science 282:850-51 -o � impact of Bt corn pollen ° on the survival of 267. Shelton AM,Tang JD,Roush RT,Metz TD,Earle ED.2000. Field tests on managing resistance to w° nontarget monarch Bt-engineered plants.Nat.Biotechnol. 18:339-42 o butterfly larvae. 268. Shen RF,Cai H,Gong WH.2006.Transgenic Bt cotton has no apparent effect on enzymatic activities N - -- or functional diversity of microbial communities in rhizosphere soil.Plant Soil 285:149-59 0 269. Shintani D,Dellapenna D. 1998.Elevating the vitamin E content of plants through metabolic engi- o neering.Science 282:2098-100 M270. Shoemaker R, Harwood J, Day-Rubenstein K, Dunahay T, Heisey P, et al. 2001. Eco- o`4 nomic Issues in Agricultural Biotechnology. USDA Econ. Res. Serv. Info. Bull. No. http://www.ers. ° usda.gov/publications/aib762/ o N 271. Shrawat AK,Carroll RT,DePauw M,Taylor GJ,Good AG.2008.Genetic engineering of improved ni- trogen use efficiency in rice by the tissue-specific expression of alanines aminotransferase.Plant Biotechnol. J.6:722-3 2 272. Shrestha A,Hembree KJ,Va N.2007.Growth stage influences level of resistance in glyphosate resistant horseweed.Calif.Agric.61:67-70 273. Smale M,Zambrano P,Falck-Zepeda J,Gruere G.2006.Parables:Applied economics literature about the impact of genetically engineered crop varieties in developing economies.EPT Discuss.Pap.158.Int. Food Policy Res.Inst.,Washington,DC 274. Smart SM,Firbank LG,Bunce RGH,Watkins JW.2000.Quantifying changes in abundance of food plants for butterfly larvae and farmland birds.J.Appl.Ecol. 37:398-414 275. Smith CW. 1995.Crop Production:Evolution,History and Technology.New York:Wiley 276. Smyth S,Kerr WA,Davey KA.2006.Closing markets to biotechnology:does it pose an economic risk if markets are globalised?Int.J. Technol.Globilisation 2:377-89 277. Soberon M,Pardo-Lopez L,Lopez I,Gomez I,Tabashnik BE,Bravo A.2007.Engineering modified Bt toxins to counter insect resistance.Science 318:1640-42 278. Song J,Bradeen JM,Naess KS,Raasch JA,Wielgus SM,et al.2003.Gene RB cloned from Solanum bulbo- castanum confers broad spectrum resistance to potato late blight.Proc.Natl.Acad.Sci.USA 100:9128-33 279. Stanley-Horn DE,Dively GP,Hellmich RL,Mattila HR,Sears MK,et al.2001.Assessing the impact of CrylAb-expressing corn pollen on monarch butterfly larvae in field studies.Proc.Natl.Acad.Sci. USA 98:11931-36 556 Lemaux 280. Stewart CN.2004.Genetically Engineered Planet:Environmental Impacts of Genetically Engineered Plants. New York:Oxford Univ.Press 281. Sun M,Corke H.1992.Population genetics of colonizing success of weedy rye in northern California. Theor.Appl.Genet.83:321-29 282. Tabashnik BE. 1994.Evolution of resistance to Bacillus thuringiensis.Annu.Rev.Entomol. 39:47-79 283. Tabashnik BE. 1994.Delaying insect adaptation to transgenic plants:seed mixtures and refugia recon- sidered.Proc.R.Soc.London B 255:7-12 284. Tabashnik BE,Dennehy TJ,Carriere Y.2005.Delayed resistance to transgenic cotton in pink bollworm. Proc.Natl.Acad.Sci. USA 102:15389-93 285. Tabashnik BE,FabrickJA,Henderson S,Biggs RW,Yafuso CM,et al.2006.DNA screening reveals pink bollworm resistance to Bt cotton remains rare after a decade of exposure.J.Econ.Entomol.99:1525-30 - 286. Tabashnik BE, Gassmann AJ, Crowder DW,Carriere Y. 2008. Insect resistance to Bt crops: 286.Uses global evidence versus theory.Nat.Biotechnol.26:199-206 monitoring data and 287. Tanksley S,McCouch S. 1997.Seed banks and molecular maps:Unlocking genetic potential from the computer simulations to O0 investigate the o wild.Science 277:1063-66 288. Tenenbaum DJ. 2008. Food vs. fuel: Diversion of crops could cause more hunger. Environ. Health implications of the -> Perspect. 116:A254-57 effectiveness of the refuge strategy with 289. Teuber LR,Mueller S,van Deynze A,Fitzpatrick S,HaglerJR,Arias J.2007.Seed-to-seed and hay-to-seed regard to evolution of g pollen mediated gene flow in alfalfa.Presented at Proc.North Central Weed Sci. Soc., St.Louis,MO, insect resistance to Bt. 3 0 62:203,Dec.12-13 290. The Natl.Acad.2007.Agriculture at the national academies.http://www.nas.edu/agriculture oc 291. The Natl. Assoc. State Dep. Agric. (NASDA). 2004. Letter on unintended traces of biotech b ° crops identified in certified organic crops. http://www.nasda.org/NASDA-Pew/Letter%20on% a 20unintended%20traces%20of%20biotech%20crops%20identified%20in%20certified% 20organic%20crops.txt o 292. Trostle R.2008.Global agricultural supply and demand:Factors contributing to the recent increase in food commodity prices.Econ.Res.Serv.,Outlook Rep.No. WRS-0801,July 293. U.S. Grains Counc. 2008. Corn: Zea Mays, family poaceae, commonly known as Maize. http:// o www.grains.org/corn • r• mm 294. UN Econ. Soc. Comm. Asia Pacific. 2008. Population and Social Integration Section (PSIS). o ° Most population growth to come from developing countries http://www.unescap.org/esid/psis/ ° population/popheadline/305/art6.asp o N 295. UNMillenn.Proj.2006.Goals,targets and indicators.http://www.unmillenniumproject.org/goals/gti. htm 296. Underwood BA,Smitasiri S. 1999.Micronutrient malnutrition:Policies and programs for control and their implications.Annu.Rev.Nutr. 19:303-24 297. Univ. Calif., San Francisco. 2007. UCSF sleuths identify suspects in mystery of vanishing honeybees. http://pub.ucsf.edukoday/cache/feature/200704251.html 298. USDA Econ. Res. Serv. 2008. Adoption of genetically engineered crops in the U.S.: Corn varieties. http://wwwers.usda.gov/data/biotechcrops/extentofadoptiontable 1.htin 299. USDA Econ.Res.Serv.2008.Adoption of genetically engineered crops in the U.S.: Upland cotton varieties. http://www.ers.usda.gov/data/biotechcrops/ExtentofAdoptionTable2.htm 299a. USDA Econ. Res. Serv. 2008. Adoption of genetically engineered crops in the U.S.: Soybean varieties. http://wwwers.usda.gov/data/biotechcrops/extentofadoptiontable3.htm 300. USDA Econ. Res. Serv. 2008. Briefing rooms: Organic agriculture. http://www.ers.usda.gov/ Briefing/Organic/ 301. USDA Econ.Res.Serv.2008.FASonline:Exports by marketingyear.http://www.fas.usda.gov/esrquery/ esrqg.aspx 301a. USDA Econ. Res. Serv. 2008. Food CPI, prices and expenditures. http://www.ers.usda.gov/ Briefing/CPIFoodAndExpenditures/ 302. USDA Econ.Res. Serv.For.Agric. Serv.2008. Outlook for U.S.Agricultural Trade.AES-59,Aug. 28. http://www.fas.usda.gov/cmp/outlook/2008/Aug-08/AES-08-28-2008.pdf www.annualreviews.org • Genetically Engineered Plants and Foods 557 303. USDA For. Agric. Serv. Glob. Agric. Inf. Netw. (GAIN). 2003. Japan biotechnology update on Japan's biotechnology safety approval and labeling policies. GAIN Rep. No. JA3002. http://www. fas.usda.gov/gainfiles/200302/145884801.pdf 304. USDA For. Agric. Serv. Glob. Agric. Inf. Netw. (GAIN). 2006. Aust. GAIN Rep. No. AS6039. http://www.fas.usda.gov/gainfiles/200606/146198091.doc 305. USDA For.Agric.Serv.Glob.Agric.Inf.Netw.(GAIN).2006.Jpn.Biotechnol.Annu.Rep.2006.GAIN Rep.No.JA6049.http://www.fas.usda.gov/gainfiles/200610/146249133.doc 306. USDA For.Agric.Serv.Glob.Agric.Inf.Netw.(GAIN).2006.N.Z.Biotechnol.Annu.2006.GAIN Rep. No.NZ6010.http://www.fas.usda.gov/gainfiles/200607/146208401.doc 307. USDA For.Agric.Serv.Glob.Agric.Inf.Netw.(GAIN).2007.EU-27Biotechnol.Annu.Agric.Biotechnol. Rep.GAIN Rep.No.E47044.http://www.fas.usda.gov/gainfiles/200706/146291311.doc 308. USDA For. Agric. Serv. 2008. FAS agricultural export commodity aggregations. http://www.fas.usda. gov/USTrade/USTExFAS.asp?QI 309. USDA-ARS.1962.ARS Timeline:Improving Corn.http://www.ars.usda.gov/is/timeline/corn.htm 0 310. van Deynze A,Fitzpatrick S,Hammon B,McCaslin MH,Putnam DH,et al.2008.Gene flow in alfalfa: biology,mitigation,and potential impact on production.CAST Special Publ.28 311. VanGessel MJ. 2001. Rapid Publication: Glyphosate-resistant horseweed from Delaware. Weed Sci. 49:703-5 312. van Rensburg JBJ. 2007. First report of field resistance by stem borer Busseola fusca (Fuller) to Bt- transgenic maize.S.Afr.J.Plant Soil 24:147-51 313. Varrelmann M,Palkovics L,Maiss E.2000.Transgenic or plant expression vector-mediated recombi- o nation of Plum pox virus.J. Virol.74:7462-69 't ° 314. Vaughn T, Cavato T,Brar G,Coombe T, DeGooyer T,et aI.2005. A method of controlling corn a. rootworm feeding using a Bacillus thuringiensis protein expressed in transgenic maize.Crop Sci.45:931- °P-• °, 38 o 315. Wacek T. 1998.Patent awarded for plant gene expression.ISB News Rep.Aug.:1-2 316. Wang H,Ye Q,Wang W,Wu L,Wu W.2006.CrylAb protein from Bt transgenic rice does not residue '!r, in rhizosphere soil.Environ.Pollut. 143:449-55 0 317. Warwick SI,Legere A,Simard M J,James T.2008.Do escaped transgenes persist in nature?The case 6• ,n of an herbicide resistance transgene in a weedy Brassica rapa population.Mol.Ecol. 17:1387-95 o<-6 318. Warwick SI,Simard M-J,Legere A,Beckie HJ,Braun L,et al.2003.Hybridization between transgenic o Brassica napus L.and its wild relatives:Brassica rapa L.,Raphanus raphanistrum L.,Sinapis arvensis L., o_N and Erucastrum gallicum(Willd.)O.E.Schulz.Theor.Appl.Genet. 107:528-39 p 319. Watkinson AR,Freckleton RP,Robinson RA,Sutherland WJ.2000.Predictions of biodiversity response a to genetically modified herbicide-tolerant crops.Science 289:1554-57 320. Watrud LS,Lee EH,Fairbrother A,Burdick C,Reichman JR,et al.2004.Evidence for landscape-level, pollen-mediated gene flow from genetically modified creeping bentgrass with CP4 EPSPS as a marker. Proc.Natl.Acad.Sci. USA 101:14533-38 321. Watson JM,Fusaro AF,Wang MB,Waterhouse PM.2005.RNA silencing platforms in plants.FEBS Lett. 579:5982-87 322. Weber CL,Matthews HS.2008. Food-miles and the relative climate impacts of food choices in the United States.Environ.Sci.Technol.42:3508-13 323. Webster TM.2000.The southern states 10 most common and troublesome weeds in rice.Proc.South Weed Sci.Soc.53:247-74 324. Wehrmann A,Van Vliet A,Opsomer C,Botterman J,Schulz A. 1996.The similarities of bar and pat gene products make them equally applicable for plant engineers.Nat.Biotechnol. 14:1274-78 325. Wintermantel WM,Schoelz JE.1996.Isolation of recombinant viruses between cauliflower mosaic virus and a viral gene in transgenic plants under conditions of moderate selection pressure.Virology 223:156- 64 326. Witkowski JF, Wedberg JL, Steffey KL, Sloderbeck PE, Siegfried BD, et al. 2008. Bt corn and the European Corn Borer. Long-Term Success through Resistance Management. Univ. Minn. WW07055. http://www.extension.umn.edu/distribution/cropsystems/DC7055.html 558 Lemons 327. World Trade Organ. 2008. European Communities Measures Affecting the Approval and Mar- keting of Biotech Products. Dispute Settlement DS293. http://www.wto.org/english/tratop_ e/dispu_e/cases_e/1 pageswn_e/ds293 sum_e.pdf 328. World Trade Organ. 2008. Introduction to the SPS Agreement. http://www.wto.org/english/ tratop_e/sps_e/sps_agreement_cbt_e/cls1p1_e.htm 329. Wraight CL,Zangerl AR,Carroll MJ,Berenbaum MR.2000.Absence of toxicity of Bacillus thuringiensis pollen to black swallowtails under field conditions.Proc.Natl.Acad.Sci. USA 97:7700-3 330. Wright BD, Pardey PG.2006. Changing intellectual property regimes:implications for developing country agriculture.Int.J.Technol.Globilisation 2:93-114 331. Wu F. 2006. Mycotoxin reduction in Bt corn: potential economic, health, and regulatory impacts. Transgenic Res. 15:277-89 332. Wu F.2007.Bt corn and impact on mycotoxins.CAB Rev.:Perspect.Agric.Vet.Sci.Nutr.Nat.Resour.2:8 333. Xu X,Yu L,Wu Y.2005.Disruption of a cadherin gene associated with resistance to CrylAc b-endotoxin of Bacillus thuringiensis in Helicoverpa armigera.Appl.Environ.Microbiol.71:948-54 • 334. Ye X,AI-Babili S,Kloti A,Zhang J,Lucca P,et al.2000.Engineering the provitamin A(beta-carotene) biosynthetic pathway into(carotenoid-free)rice endosperm.Science 287:303-5 335. Zapiola ML,Mallory-Smith CA,Thompson JH,Rue LJ,Campbell CK,Butler MD.2007.Gene escape from glyphosate-resistant creeping bentgrass fields:past present and future. Presented at 60th Meet.West. Soc.Weed Sci.,Portland,OR,March 13-15 338.Use of a model 3 0 336. Zhang H-X,Blumwald E.2001.Transgenic salt-tolerant tomato plants accumulate salt in foliage but plant system to • o not in fruit.Nat.Biotechnol. 19:765-68 investigate and P predict 3 E 337. Zhao J-Z, Cao J,Collins HL,Bates SL,Roush RT, et al.2005. Concurrent use of transgenic plants the implications of hexpressing a single and two Bacillus thuringiensis genes speeds insect adaptation to pyramided plants. releasing single versus Proc.Natl.Acad.Sci. USA 102:8426-30 pyramided two-gene Bt 0 0 338. Zhao J-Z, Cao J,Li Y,Collins HL,Roush RT, et al.2003.Transgenic plants expressing two plants on development c w of resistance to Bt. Bacillus thuringiensis toxins delay insect resistance evolution.Nat.Biotechnol.21:1493-97 Q m O;N won V1 O • o ▪cfi ,n M cn �m a - N ri O N W a a d 00 www.annualreviews.org • Genetically Engineered Plants and Foods 559 Annual Review of Plant Biology Contents Volume 60,2009 My Journey From Horticulture to Plant Biology Jan A.D. Zeevaart 1 Roles of Proteolysis in Plant Self-Incompatibility Yijing Zhang, Zhonghua Zhao,and Yongbiao Xue 21 Epigenetic Regulation of Transposable Elements in Plants Damon Lisch 43 0 14-3-3 and FHA Domains Mediate Phosphoprotein Interactions a ; David Chevalier,Erin R.Morris,and John C. Walker 67 9 Quantitative Genomics:Analyzing Intraspecific Variation Using bu. Global Gene Expression Polymorphisms or eQTLs ° Dan Kliebenstein 93 3r Q N DNA Transfer from Organelles to the Nucleus:The Idiosyncratic • Genetics of Endosymbiosis MTatjana Kleine, Uwe G.Maier, and Dario Leister 115 The HSP9O-SGT1 Chaperone Complex for NLR Immune Sensors (.1-4 Ken Shirasu 139 76'`'N >, Cellulosic Biofuels Andrew Carroll and Chris Somerville 165 Jasmonate Passes Muster:A Receptor and Targets 6 for the Defense Hormone John Browse 183 Phloem Transport: Cellular Pathways and Molecular Trafficking Robert Turgeon and Shmuel Wolf 207 Selaginella and 400 Million Years of Separation Jo Ann Banks 223 Sensing and Responding to Excess Light Zhirong Li, Setsuko Wakao,Beat B. Fischer,and Krishna K Niyogi 239 Aquilegia:A New Model for Plant Development, Ecology, and Evolution Elena M. Kramer 261 v Environmental Effects on Spatial and Temporal Patterns of Leaf and Root Growth Achim Walter, Wendy K Silk, and Ulrich Schurr 279 Short-Read Sequencing Technologies for Transcriptional Analyses Stacey A. Simon,Jixian Zhai,Raja Sekhar Nandety,Kevin P. McCormick, Jia Zeng, Diego Mejia, and Blake C.Meyers 305 Biosynthesis of Plant Isoprenoids: Perspectives for Microbial Engineering James Kirby and Jay D. Keasling 335 The Circadian System in Higher Plants Stacey L. Harmer 357 0 A Renaissance of Elicitors:Perception of Microbe-Associated Molecular Patterns and Danger Signals by Pattern-Recognition Receptors Thomas Boller and Georg Felix 379 3 0 3 a Signal Transduction in Responses to UV-B Radiation o C Gareth I.Jenkins 407 w 2 -o o. Bias in Plant Gene Content Following Different Sorts of Duplication: Tandem,Whole-Genome, Segmental,or by Transposition o Q z•-n- Michael Freeling 433 • Photorespiratory Metabolism: Genes,Mutants,Energetics, and Redox Signaling Christine H. Foyer,Arnold Bloom, Guillaume Queval, and Graham Noctor 455 00 Roles of Plant Small RNAs in Biotic Stress Responses TVirginia Ruiz-Ferrer and Olivier Voinnet 485 C-0 w Genetically Engineered Plants and Foods:A Scientist's Analysis a of the Issues(Part II) Peggy G. Lemaux 511 The Role of Hybridization in Plant Speciation Pamela S. Soltis and Douglas E. Soltis 561 Indexes Cumulative Index of Contributing Authors,Volumes 50-60 589 Cumulative Index of Chapter Titles,Volumes 50-60 594 Errata An online log of corrections to Annual Review of Plant Biology articles may be found at http://plant.annualreviews.org/ vi Contents /o • n C) W Genetically Engineered >rn r • Plants and Foods: A Scientist's Analysis a of the issues (Part I) Peggy G. Lemaux o Department of Plant and Microbial Biology,University of California,Berkeley, California 94720;email:lemauapg@nature.berkeley.edu 0 0 ,N • C u" O.M-. N 0o O r O Annu.Rev Plant Biol.2008.59:771-812 Key Words '4 �M o First published online as a Review in Advance on benefits,biotechnology,crops,food safety,genetic engineering, February 19,2008 risks The Annual Review of-Plant Biology is online at plant.annualreviews.org Abstract >7' This article's doh Through the use of the new tools of genetic engineering,genes can t4 10.1146/annurevarplant.58.032806.103840 x be introduced into the same plant or animal species or into plants or Copyright©2008 by Annual Reviews. animals that are not sexually compatible—the latter is a distinction All rights reserved with classical breeding.This technology has led to the commercial 1543-5008/08/0602-0771$20.00 production of genetically engineered(GE)crops on approximately 250 million acres worldwide. These crops generally are herbicide and pest tolerant,but other GE crops in the pipeline focus on other traits.For some farmers and consumers,planting and eating foods from these crops are acceptable;for others they raise issues related to safety of the foods and the environment.In Part I of this review some general and food issues raised regarding GE crops and foods will be addressed.Responses to these issues,where possible,cite peer- reviewed scientific literature. In Part H to appear in 2009, issues related to environmental and socioeconomic aspects of GE crops and foods will be covered. 771 Contents 1.INTRODUCTION 773 3.6.Do Genetically Engineered 2.GENERAL ISSUES 773 Foods Have Changes in 2.1.Terminology 773 Nutritional Content? 783 2.2.Besides Genetically 3.7.Is the Bt Protein Safe for Engineered Crops,Does Human Consumption? 784 Genetic Engineering Play a 3.8.Have Allergens Been Role in Producing Food?... 774 Introduced into Foods 2.3.How Does the Creation of a Through Genetic Genetically Engineered Engineering? 786 Crop Differ from That of a 3.9.Were Foods Made From Bt Classically Bred Crop? 774 Corn Removed from the 0 2.4.Can Marker-Assisted Market Because of 3 Selection Be Used Instead Allergenicity ,>>, of Genetic Engineering to Concerns? 786 .i Improve Crops? 774 3.10.Do Only Genetically 1 2.5.Does the Use of rDNA Engineered Foods Cause 12 Always Involve Moving Food Allergies? 787 0 Genes from One Organism 3.11.Can Genetically 1 to Another? 775 Engineered Foods Have a 2.6.Which U.S.Agencies Have Fewer Allergens than o cc;.=4 Regulatory Authority Over Non-GE Foods? 788 r`i Genetically Engineered and 3.12.Do Viral Sequences Used A..,-.N Classically Bred Crops) 776 in Plant Genetic cl 0 2.7.Which Genetically Engineering Create a c Engineered Crops Are Human Health Risk? 788 Grown Commercially? 777 3.13.Can Genetically CD r 2.8.How Many Foods Are Engineered Foods Increase ;; Genetically Engineered? 777 Antibiotic Resistance in 2.9.What Is in the Crop Human and Animal T '-° Biotechnology Pipeline? 778 Intestinal Flora? 789 °' 3.FOOD ISSUES 779 3.14.Can Genetically ; 3.1.Did People Die After Engineered Food Crops a Consuming Tryptophan Be Used to Make IMade By Genetically Pharmaceuticals?Could Engineered Bacteria) 779 They Contaminate the 3.2,Were Potatoes Genetically Food Supply? 789 Engineered with a Lectin 3.15.Why Doesn't the FDA Protein Unsafe to Eat? 780 Require Labeling of 3.3.Were Fish Genes Introduced Genetically Engineered into Strawberries? 780 Foods? 790 3.4.Are Food Safety Studies 3.16.Are Organic Foods Conducted on GE Foods?.. 780 Healthier or Safer) 791 3.5.What Happens to the DNA 3.17.Should Genetically in Foods When They Are Engineered Crops and Eaten? 782 Foods Be Banned Until 772 Lemaux They Are Proven to Be part of the considerations for using and con- 100%Safe? 793 suming these crops,issues beyond the techni- cal,S.Are Milk and Meat from ca, science-based facts also need to be con- ? sidered. Here, aspects of a number of issues GE: genetically Cloned Cows Safe to Eat794 P engineered 3.19,Is Milk from rbGH- related to GE crops and foods are reviewed Recombinant DNA Injected Cows Safe?Why from a detailed scientific viewpoint. Not all (rDNA): DNA that Isn't It Labeled? 794 issues raised are discussed and not all aspects is manipulated in the 3.20.Can the USDA Stop the of the issues raised are addressed. laboratory using Planting of Genetically recombinant DNA technologies Engineered Crops that Pose Health or 2. GENERAL ISSUES GMO: genetically modified organism Environmental Risks? 795 3.21.Is Golden Rice the Only 2.1.Terminology c Way to Provide Vitamin A Biotechnology literally means the use of a liv- Eto People in Developing ing organism(hence,"bio")to perform a task Countries] 796 or function.Historically the term was used to 8 4.CONCLUDING REMARKS 797 describe processes like cheese,yogurt,wine, o or beer production.In modern parlance,how- ever,biotechnology is commonly used to refer 0 2 1.INTRODUCTION to the newer methods of genetic engineer- 4r4 a "Be very,very careful what you put into that ing of organisms through the use of recom mt c head,because you will never,ever get it out," binant DNA or rDNA People use the term " said Thomas Cardinal Wolsey(1471-1530). GMO today to refer to a genetically modified A n Although spoken centuries ago,this admoni- organism, one that has been engineered us - A kn lion rings true today when it comes to the ing rDNA. Others refer to foods created in o impact of information people receive,partic- this manner as genetically engineered or GE M ularly in the popular press, about genetically foods.So,a GE or GMO food is a food modi- ce engineered(GE)crops and foods.Genetic en- fled using rDNA methods or one that contains ° gineering enables the introduction of genes, a GE ingredient.The term LMO, for living o N using the modem tools of recombinant DNA modified organism, refers to a GE organism °n a that is alive,such as a fresh fruit,vegetable,or '.a (rDNA), from the same species into an or- w ganism;of more concern to some,genes from seed that was created using rDNA.A seed is 1:(4) organisms in other kingdoms can be intro- an LMO,whereas flour made from seeds or g duced.Although much relating to GE crops grain would not be an LMO.Use of the terms and foods has been written, both pro and GMO and LMO can be confusing,especially con,this review attempts,where possible,to to geneticists, given that all foods eaten to address issues by linking responses to peer- day have been altered or modified genetically reviewed literature. The intent is to present through natural or human-imposed muta- as accurate a scientific picture as possible,al- tions or crossing.Frankenfoods,or Franken- stein foods,is a term first coined by Paul Lewis though this does not imply that people pos will stein his 1992 letter to the Editor of the New York sessing the same scientific understanding necessarily make the same choices about the Times(139),arguing against GE tomatoes and advisability of GE crops for consumption,be- calling for action against Frankenfoods. The cause different people have different values. term gained popularity after 1998 when non- GE crops,and products made from them, governmental organizations (NGOs) started must be evaluated on a case-by-case basis and, using the term to call consumers to action although scientific information should be a against GE foods(102). www.annualrec'iews.org•Issues with GE Plants and Foods 773 2.2.Besides Genetically Engineered breeding versus those made via rDNA meth- Crops,Does Genetic Engineering ods.Both approaches can involve changes in GRAS: generally Play a Role in Producing Food? the sequence,order,and regulation of genes in recognized as safe Much processed food is produced using an organism and can utilize many of the same Classical breeding: enzymes, or whole organisms with enzymes, enzymes.However,with the rDNA approach methods used by that are responsible for altering the nature of the amount of genetic information modified is humans to facilitate the food—such as bacteria(e.g.,yogurt),yeast small,one or a few genes,compared with the genetic exchange (e.g.,beer,wine),and multicellular fungi(e.g., classical breeding approach where all the tens between one of thousands of genes in the organism are in- organism and blue cheese). These enzymes were modified another genetically through traditional methods and volved,potentially exchanging positions.An- in some cases rDNA methods as well.One ex other difference is that with the rDNA ap ample of the latter is the modification of an en- proach when and where a gene product is e zyme used in making cheese,rennin.This en- <? made can be controlled precisely. Thus, if zyme is present in rennet,historically isolated a change in seed characteristics is desired, a from the stomachs of slaughtered calves where gene can be linked to regulatory signals that . it was needed to clot mother's milk to slow its result in expression only in the seed or even digestion.In cheese-making,rennet is used to in a specific compartment of the seed(43)— o coagulate milk to separate the curds (solids) an outcome difficult to achieve with classical and whey (liquid). Rennin or chymosin was breeding. 8�, the first protein produced through rDNA With classical breeding approaches, 4.-4 ° means to be used in food(95).The chymosin crosses can only be accomplished between i .6 gene from a cow was cloned into yeast and closely related species or genera. For ex- 2 w Escherichia colt, from which rennin can be ample, a wild Lycopersicon variety can be 0= made in larger quantities and with more crossed with cultivated tomato (Lycopersicon Aconsistent quality than from calves'stomachs. esculentum)varieties(42),and wheat(Triticunz 4,a Engineered chymosin is currently used in aestivunz) can be crossed with rye (Secale 0 approximately 60% of U.S. hard cheese cereale) to yield triticale (218). But in many 6:'M products(27). crosses, wild relatives and different genera vo P or species are not compatible or crosses can c, Other products produced by rDNA meth- ods include food supplements,such as vitamin be made but the resulting embryos must °:>. B2(riboflavin)(181),a-amylase(used to pro- .g' be rescued by in vitro culture to obtain a a duce high-fructose corn syrup and dry beer), plant (204). In contrast, rDNA approaches and lactase(added to milk to reduce the lac- can utilize genetic material from any living 4 tose content for persons with lactose intol- organism,which permits DNA from bacterial 1 erance).The Food and Drug Administration or animal sources to be introduced into (FDA) granted GRAS (generally recognized plants. Therefore, rDNA can result in gene as safe) (See section 3.4)status for these en combinations not previously seen. zymes produced by GE microorganisms prior to their use in food(125). 2.4. Can Marker-Assisted Selection Be Used Instead of Genetic Engineering to Improve Crops? 2.3.How Does the Creation When it is determined what genic sequences of a Genetically Engineered are responsible for certain traits, that in- Crop Differ from That of a formation can be used to develop breeding Classically Bred Crop? aids. The ability to select desirable alleles Similarities and differences exist between the and eliminate deleterious ones in a fast,reli- modifications made in organisms by classical able manner is critical to the development of 774 1217141 IX improved germplasm through breeding. Ge- 2.5.Does the Use of rDNA Always netic markers can speed identification of Involve Moving Genes from One plants with esired (or deleterious) alleles Organism to Another? MAS: marker- in large populations via a process termed Using rDNA methods, a gene from any liv- assisted selection marker assisted selection (MAS). Markers mg organism can be inserted into a plant Substantial closely linked to desired traits are used to and,given appropriate regulatory signals and equivalence: an select indirectly for the trait (58). With the codon usage, can be expressed efficiently in assessment of a new whole and partial genome sequences and a plant cell. To introduce a gene from the food must other molecular tools now available, mark- demonstrate it is as same or a heterologous source, the gene safe as its ers can now be identified in the responsible must he identified in a donor organism and conventional gene, rather than linked to it, which makes cloned into a bacterium to obtain sufficient counterpart MAS even more valuable.Thus,a marker was DNA to build plant transformation vectors found in Xa5, a rice (Oryza sativa) bacterial (210)and perform the transformation.Given 0' blight disease resistance gene,and its use pre- the intermediate bacterial step,even if struc- 3 vented separation of the marker from the trait tural genes and regulatory sequences are from t, by recombination(115). the plant, plant transformation would in- MAS is particularly valuable for traits volve moving DNA from one organism to awhen a) phenotypic screens in the field are another. difficult or costly, e.g., drought/frost toler- Sources of genes to engineer plants can o ance or resistance to exotic diseases or pests; be derived from the same plant, a different ° b)multiple alleles exist;and c)recessive or low plant, a related wild species, or from bac- ED a heritability traits exist that require progeny teria, fungi, viruses, and mammals. The ca- n w o o testing. MAS is used for some important c w pacity to introduce genes from different liv- traits,e.g.,leaf rust resistance in wheat(165), ing organisms raises the issue of whether all A N erect panicle in rice (126), soybean (Glycine engineered plants, regardless of the source on a max) rust resistance (108), drought adapta of the genetic material, should be consid ° tion in maize (190), and root knot nema- ered as a homogeneous group.Alternatively, rn tole resistance in cotton(Gohypium birsutum) e it has been suggested that GE plants be placed °O (255). Or- in three classes: i) wide transfer, referring o N Utilization of GE crop varieties is not per to gene movement from organisms of other nutted for organic growers.National Organic kingdoms into plants;ii)close transfer,refer- >, aStandards specify that these varieties cannot ring to movement between species of plants; he intentionally grown by organic farmers and iii)tweaking,referring to the manipula- and labeled"organic"(161)(See section 3.16); tion of levels or patterns of expression of genes q however,MAS can be used to introduce de- sired ready present in the plant(232). a9 traits from wild or related species and Using such a classification scheme would these species are acceptable to organic grow provide some clarity to several issues relat- ers.However, this approach is limited to di ing to regulation and public perception of GE versify extant in sexually compatible species, crops.A determination of substantial equiva- which is often not sufficiently broad to pro- lence(See section 3.4)could then be carried vide needed traits. Utilizing MAS to create out at different levels of scrutiny, depend- food crops has led to the term, "Super Or- ing on classification level. A GE plant cre- ganics" (144), crops that are grown under ated by tweaking or close transfer would result certified organic conditions and were cre- in changes unlikely to be dramatically differ- ated through classical breeding using genomic ent from those created by processes used by information and MAS, not through rDNA traditional breeders.Conversely,introduction methods. wz m.annnalre:'iews.org •Issues with GE Plants and Foods 775 via a wide transfer would likely require more field-testing GE plants; their role is to en- thorough testing to establish substantial sure that field tests of GE crops are conducted EPA equivalence. under controlled conditions and that any un- Environmental usual occurrences are reported. Every GE Protection Agency crop will not be overseen by all three agen- 2.6.'Which U.S.Agencies Have USDA: United cies;however,all three agencies have the legal Regulatory Authority Over States Department power to ask for immediate removal from the of Agriculture Genetically Engineered and market of any product,if valid scientific data Pesticide: any Classically Bred Crops? show a safety concern for consumers or the substance or mixture In the early 1980s,the U.S.established a for- environment. of substances that mal regulatory structure for GE organisms The federal government considers each prevents,destroys, by expanding existing legislation to accom- GE plant with a specific DNA segment repels,or mitigates any pest,including modate products created by rDNA.This ap- introduced via rDNA methods to be a o insects,weeds,fungi, proach was outlined in an Office of Science "regulated article" and each gene transfer bacteria,viruses, and Technology Policy document entitled Go- is defined as an event. Creating a second mice,and other ordinated Framework for Regulation of Biotech- transformed plant with an identical DNA animals nology (169), which established the concept construct inserted in a different location is ht: Bacillus that GE foods would be regulated on the basis considered to be a separate event,a regulated thuringiensis of product,not process,and on a case-by-case article requiring oversight, even if the fast APHIS: Animal and basis. event received regulatory approval and Plant Health ry a PP e Inspection Service GE foods and products made from them attained nonregulated status. As of October a are under regulatory control of three federal 2007, 113 petitions have been received at 'o c EIS: environmental agencies: the FDA, the Environmental Pro- APHIS; 90 petitions received nonregulation 2 w impact statement o tection Agency(EPA), and the U.S. Depart- status and no longer require APHIS review C]M ment of Agriculture(USDA)(see 150 for a re- for movement or release in the U.S.(113). 0. c, view).The FDA is responsible for the safety In 2005,an audit by the USDA Inspector r` o and labeling of foods and animal feeds from General(110)indicated the USDA lacked ba- v■ all crops, including those that are GE. The sic information about where GE crops were oFDA requires full evaluations of GE foods grown and their fate after harvest, raising rs''" containing uncharacterized DNA sequences, concerns particularly about the fate of crops cari significantly altered nutrient levels, different engineered to produce pharmaceuticals (See composition relative to existing foods,poten- section 3.14). Two additional concerns were tially allergenic or toxic proteins,and/or new raised in 2007. First, a U.S. federal court n selection marker genes. The EPA evaluates ordered the USDA to conduct more de- food safety and environmental issues associ- tailed reviews of applications for experimen- ated with new pesticides and pesticidal prod- tal plots of GE bent grass when pollen was ucts.Bt corn(Bacillus thuringiensis;Zea mays) found to have spread 13 miles from the orig- and the pesticidal Bt product it contains,used final cultivation site (61). Second, in early to control the European corn borer, for ex- 2007 questions were raised about the approval ample, fall under its jurisdiction. The EPA's of deregulation status for Roundup Ready® control also encompasses GE plants in which alfalfa when a U.S. District Court Judge a small part of a pest, such as a viral regu- ruled that the USDA had erred in approving latory sequence (e.g., 35S promoter),is used deregulation without a proper environmen- to develop the GE crop. A division of the tal impact statement(EIS).Roundup Ready® USDA,the Animal and Plant Health Inspec- alfalfa was returned to regulated status,pend- tion Service(APHIS), oversees environmen- ing submission and review of an appropriate tat consequences and safety of planting and EIS(11). 776 Le711a:1x 2.7.Which Genetically Engineered 2.8.How Many Foods Are Crops Are Grown Commercially? Genetically Engineered? The first GE plant was tobacco, reported Estimates suggest that as much as 80% of HT: herbicide in 1983 (23), but no plants were commer- U.S.processed food may contain an ingredi- tolerant cially grown until the FlavrSavrTM tomato ent from a GE crop,such as corn starch,high- was commercialized in 1994(146).Although fructose corn syrup,corn oil,canola oil,soy- the FlavrSavrTM tomato was ultimately taken bean oil,soy flour,soy lecithin,or cottonseed off the market, other commercial crops en- oil(98).Despite this percentage in processed tered the market—most notably large acreage foods,there are very few commercially avail- crops, such as canola (Brassica napes), corn, able whole GE foods. The first commercial cotton, soybean, and most recently, alfalfa GE whole food was the FlavrSavrTM tomato, (Medicago sativa)(See section 3.20).If success engineered to have a longer shelf life (129) is measured by increases in global acreage or so tomatoes could be kept on the vine longer farmer acceptance, certainly these GE crops to ripen,develop more flavor,and allow later have been successful. In 2005, the billionth shipments to stores.Although grown in Cal- acre of a GE crop was planted(116).In 2006 ifornia,the tomatoes were made into tomato the worldwide acreage of GE crops was 252 paste, clearly labeled, and sold in the U.K. omillion acres grown by 10.3 million farmers in The paste gained an estimated 60% share of 22 countries(117);the majority of the farm- the canned tomato market by 1999,but left ers are in the U.S.and almost none are in Eu- the market shortly thereafter owing to mar- o rope. In the U.S. the adoption of herbicide- ket concerns(146).Endless SummerTM toma- a tolerant(HT) soybeans represented 87% of toes,also engineered to control ripening and c w total U.S.soybean acreage in 2006.HT cot- introduced at approximately the same time, o ton represented 60% of total cotton acreage were commercially available for only a short (71); pest-resistant (Bt) cotton was 52%, time. °O°° whereas Bt corn was 35% of total corn GE papaya is the only engineered fruit ,° acreage. commercially available in the U.S.today.This Despite sizeable GE crop acreage,the di- occurred because in Hawaii,where most pa- x;v) :2> versity of crop types and traits in commer- payas for the U.S. are grown, production o N cial production is limited.Few minor acreage fell owing to losses to papaya ringspot virus, GE crops are at present commercially suc- PRSV(93).PRSV,discovered in Hawaii in the cessful, i.e., papaya (Carica papaya), certain 1940s, virtually eliminated large-scale pro- types of squash(Cucurbita sp.),and sweet corn duction on Oahu in the 1950s, forcing the aC (117). Nearly all major-acreage, commercial industry to relocate in the early 1960s to the releases of GE crops are based on pest pro- island of Hawaii.There it thrived,which led tection via genes from Bt or HT, predom- to 95% of Hawaii's papaya being produced inantly resulting in tolerance to Monsanto's there by the 1980s. Delay in spread of the RoundUp®herbicide,although some result in disease gave researchers time to look at pos- tolerance to Bayer's Liberty®herbicide.More sibilities to protect against the virus. Infect- recently,stacked versions of these traits were ing papaya with milder virus strains(205)met released—e.g., maize engineered for root- with limited success owing to a more ag- worm and European corn borer resistance gressive PRSV, but a GE papaya containing (both Bt-based)and tolerance to RoundUp®. a viral coat protein gene was successful (92, Except GE papaya, all commercial varieties 141). In 2006 the GE varieties "Rainbow" in 2007 are from the private,not the public, and"SunUp"accounted for>50%of papaya sector. production in Hawaii, although much of the wurm.ann uelrwiews o g•Issues with GE Plants and Foods 777 papaya consumed in the U.S.is from Brazil, 2.9.What Is in the Crop Mexico, and the Caribbean,where PRSV is Biotechnology Pipeline? not a serious problem. Although commercialized GE crops are lim- Another commercial whole food available ited in trait diversity, proof-of-concept for in the U.S.is GE squash(yellow crookneck, many other traits has been reported in labo- straightneck, and zucchini). The first van- ratory experiments and small-scale field tri- ety of GE yellow squash, termed Freedom als. These traits fit into several categories: II, was the second GE crop to be cleared pest resistance,agronomic performance,abi- by U.S. regulators. Freedom II was engi- otic stress tolerance, medical applications, neered with viral coat protein genes to be re- biofuels, and improved food, feed, and sistant to two viruses—Watermelon Mosaic environment. Vu-us 2 (WMV2) and Zucchini Yellow Mo Pest resistance traits are aimed at itnprov- saic Virus(ZYMV)(238).Freedom II reached o the market in 1995 but was not labeled like ing crop performance by protecting against 3 the FlavrSavrTM tomato.Viral resistance was pests.For example,researchers found a gene .F; transferred to zucchini by breeding and,be in the genome of a wild Mexican potato (Solanum tuberosum) variety that was subse- quently squash is usually infected with a third quently engineered into cultivated potato,al- '71 virus,Cucumber Mosaic Virus(CMV),a GE lowing the GE potato to survive exposure to squash resistant to all three viruses was devel- the many races of Pbytopbthora infestans, the oped. Six varieties of GE yellow squash and 0 0 fungus responsible for the Irish potato famine ,;, e zucchini, bearing various names, e.g., Inde- (215). A native gene, Mi, from tomato was a pendence II,Liberator III,Freedom III,and upregulated to protect the roots against root 0 0 Destiny III, are currently being sold. U.S. -444 knot nematode (196). Although Europe has o acreage is limited in part because of the nega- been reluctant to embrace engineered crops, a N tive effects of other viruses against which the • GE varieties are not protected,but resistance the first field trial of GE grapes(Vitis vinifer a) CO 0 took place in the northern Alsace region of M to the original three viruses remains strong France in 2005.A coat protein gene from fan- g 1`^• (88). '^' leaf virus was inserted into the grape rootstock o The last whole GE food available in the (29),but not in the scion, the portion of the o N U.S. is GE sweet corn,engineered with a Bt plant that bears fruit. gene to protect against earworms (Helicon Some traits aimed at improving field per- e a erpa zea), one of the most costly crop pests formance of crops for farmers could, given in North America. Earworm damage results ain subsequent fungal and bacterial attack and responsible usage, also positively impact the environment. One key aspect of crop per- quality loss (107). Expressing Bt in corn re- formance is yield. In 2001, transgenic rice salts in reductions in insect attack. By re plants expressing the maize proteins pyruvate ducing insect damage, mycotoxigenic fungi orthophosphate dikinase (PPDK) and phos- numbers are decreased and this results in phoenolpyruvate carboxylase (PEPC) exhib- lower levels of mycotoxins, such as Eamon- ited a higher photosynthetic capacity(>35%) isms,which have toxic effects on humans such compared with untransformed plants (130). as elevated rates of liver and/or esophageal Another agronomic improvement focuses on cancer (243). Comparing fumonisin levels nitrogen use efficiency,aimed at reducing fer- in corn from Bt hybrids versus control by tilizer usage and increasing sustainability.The brids, Bt hybrids give higher percentages plant-specific transcription factor Dofl,when of grain suitable for human and animal use Introduced into the model plant species Ara- (99). bidopsis,increased nitrogen content by^-30%, 778 Lemaecr improving growth under low-nitrogen condi- systems can degrade microcrystalline cellu- tions(253). lose and straw(72).Efforts are also aimed at Another focus is on improving abiotic improving the ability of engineered plants and Allergenicity: stress tolerance, e.g., high salt, high and microbes to process cellulosic biomass into us- reaction to a low water availability, and temperature ex- able biofuels(For reviews,see 221 and 237). substance that is tremes.Constitutive expression of CBF genes foreign to the body from the cold response pathway in GE Ara- and can cause a bidopsis induces expression of target COR 3.FOOD ISSUES hypersensitive or allergic reaction in (cold-regulated) genes and enhances freez- The topics addressed in this section represent certain people ing tolerance in nonacclimated plants (140). some major issues that have been raised re- Nutritional Transgenic tomato plants overexpressing a garding GE foods.These include food safety composition: vacuolar Na+/H+antiportproduce fruit when of GE plants and animals,pharma crops, la- includes protein, grown in 200 mM sodium chloride,^-40%of beling,allergenicity,nutritional composition, carbohydrate,fat, sea water concentration(257),and the tomato organic foods,and food safety testing. vitamins,minerals, fruits display very low sodium content. The fiUe,moisture,and first use of GE to alter nutritional quality phytochemical levels Cri was the introduction of three genes into rice 3.1.Did People Die After to create the much publicized Golden Rice Consuming Tryptophan Made By variety, enriched in provitamin A(254) (See Genetically Engineered Bacteria? section 3.21).Efforts have also been success- In 1989 claims surfaced that a nutritional sup- 6 ful in increasing calcium levels threefold in plement,L-tryptophan,used to treat insorn- o potato(174),as well as increasing folate levels nia,premenstrual syndrome,and depression, c vo in tomato(54). caused an epidemic of eosinophilia-myalgia 3 Approaches utilizing GE plants have also syndrome(EMS)in the U.S.;the number af- A M focused on combating human diseases and in- fected was reported to be"between 5000 and csi c elude the development of a subunit vaccine 10,000 people and the number of deaths near oagainst pneumonic and bubonic plague that 40"(213).All affected people had consumed is immunogenic in mice (6); a potato-based tryptophan made by one Japanese company ovaccine for hepatitis B, shown to raise im- (197)that had produced L-tryptophan using o(-4 munological responses in humans(23 3);a GE GE bacteria without incident prior to 1989. pollen vaccine that reduces allergy symptoms However,in 1989 the company changed GE 1 p (164); and an edible rice-based vaccine tar- bacterial strains and manufacturing processes, ii geted at alleviating allergic diseases such as eliminating some filtration steps and reduc- c asthma,seasonal allergies,and atopic dermati- ing by half the amount of active carbon used tis(225)(See section 3.14). for purification. Although the final product The utilization of plants to produce alter- was 99.6% pure, it still contained 60 differ- native energy sources is a present focus of ent impurities(148),any one of which could attention,given the global rise in nonrenew- have caused the illness,although the cause of able energy usage and greenhouse gas emis- the problems was never conclusively linked to sions.One approach involves engineering the the organism or the manufacturing process. green alga,Chlarydomonas reinbadtii,to pro- But reconstruction experiments (148) make duce hydrogen gas, a clean, renewable fuel it likely that the presence of the causative source (151). Paper waste, particularly from impurity was not due to the GE bacterium, newspapers, is a major environmental pol- but to the changes in processing. In a legal lutant that because of compaction remains summation, it was stated that "the fermen- in landfills for decades without decomposi- talon and later cooking of industrial sized tion. GE bacteria engineered with trifunc- lots of L-tryptophan generated the contam- tional designer cellulosomes or bifunctional inant" that was legally responsible for the www.atnuah eviews.org•Issuu with GE Plants and Foods 779 autoimmune EMS disease (234). Procedures (137)and tomato(114);it was not introduced should have been conducted to assess safety into other crops, like strawberries (Fragaria GM: genetically after changes were made in the strains and x ananassa),nor was it commercialized.The modified production methods. gene used, afa3, encoded an antifreeze pro- Tosici adverse tein,which in the blood of polar fish was found physiological effects 3.2.Were Potatoes Genetically to inhibit ice re cry stallization; however, de- following exposure Engineered with a Lectin Protein spite high mRNA levels in the leaves of trans- to a substance Unsafe to Eat? formed tobacco, no inhibition of ice recrys- In the late 1990s, Ewen &Pusztai (69) con- tallization was detected. If the approach had ducted studies on rats fed potatoes engineered been pursued,additional environmental and to express an introduced lectin gene from a food safety tests would have been conducted snowdrop plant(Galanthus nivalis), intended to study the impacts of this gene on the plant, g' e to reduce insect dams g e.After feedin th the environment, and consumers. Although m o humans consume flounder and this protein, 3 observed stomach lesions in the rats and substantial equivalence and allergenicity and concluded that "the damage to the rats did toxicity tests(See section 3.4)would have been not come from the lectin, but apparently done to assure the safety of the gene product from the same process of genetic engineering in new foods. othat is used to create the GM foods everyone However,issues with foods such as those 3 was already eating" (211). This study and engineered with a fish gene go beyond sci- wits conclusions were strongly criticized by entific risk, they raise questions of whether the scientific community (186), because the exchanges between certain organisms should � d study was conducted with too few animals (c2 Lo and inadequate be carried out.Cross-king dom transfer of an- a w° quate controls.Following the initial ° announcement of the findings to the popular imal genes to plants is not popular with con- Q N sumers worldwide(143),who are more corn- ("1 C press,the original study was published in the fortable with gene transfer among plants or °.° Lancet to provide researchers an opportunity between plants and bacteria(118).In fact,in M to view the data.But the data in the paper left o r-; researchers unable to draw firm conclusions a 2001 poll, 33/o of U.S. respondents be- ,t-G h (134)or confirm or deny results. The U.K.'s lieved that it was not possible to transfer an- o e°°, Royal Society criticized the study for lack of imal genes into plants and 16%weren't sure e n proper controls. In the same issue of Lancet (199).To date,no human or animal genes have EC in which the paper was published, Dutch been introduced into any commercialized GE scientists concluded the observed toxic effects crops in the U.S., but rice engineered with x human lysostaphin and lysozyme to combat might be due to nutritional differences be childhood diarrhea (256) has been grown in tween control and GE potatoes,not from the GE process(133).To reach firm conclusions, the field(87). experiments should be repeated on larger numbers of animals with proper controls. 3.4.Are Food Safety Studies Notably, this product was not marketed and Conducted on GE Foods? the results do not extend to safety analyses of GE foods and products made from GE crops other GE crops.(See section 3.4) that are used in foods today have undergone 3.3.Were Fish Genes Introduced safety testing by the companies or institutions that developed them (See sections 3.6 and into Strawberries? 3.7).The data were then reviewed by federal An antifreeze gene from Artic flounder was regulatory agencies.Frequently GE foods and introduced into tobacco and tomato (103) products made from GE crops are also tested and field-tested in tobacco(Nicotiana tobacum) by outside groups and the results published in 780 Lennox peer-reviewed journals.This process is corn- starch,amino acid,vitamin,mineral,and phy- parable to safety assessments done for phar- tonutrient composition (20, 209, 229). GE maceutical drugs and biomarkers; pharma- foods can be designated substantially equiv- Cry: crystal protein ceutical companies provide safety data that are alent to their existing counterparts, substan- subsequently _ p reviewed by FDA scientists(82). tially equivalent except for certain defined Consultation with and submission to regula- differences (on which safety assessments are tory agencies of certain safety data for GE then needed), or not substantially equiva- foods is voluntary,as are some data for phar- lent, meaning more safety testing and fur- maceutical products (82);however, the legal ther review are necessary.When making such requirements that foods (and pharmaceuti- comparisons, it is important to note that cals)have to meet are not voluntary.Although the composition of components varies across GE foods can be marketed without certain a range—whether conventional, organic, or regulatory approvals, to date all products in GE. For example,when polyphenol profiles 2° the marketplace have undergone full review of fresh apple juices from various apple(Males 3,0 by regulatory agencies regarding safety and dowestica)cultivars and commercially available , content relative to unmodified forms(search- apple juices were compared,significant differ- able data on specific events available at 84). ences were found in total polyphenol content, Submitting the safety data is in the devel- as well as in profiles of individual polyphenols, oper's best interests,however,given the legal as analyzed by high-performance liquid chro- liabilities incurred should a problem with the matography (HPLC)-photodiode array de- o e food arise following market introduction(See tection and HPLC-electrospray ionization- -0 a section 3.14). tandem mass spectrometry(123). o wThe EPA focuses on environmental and Large numbers of animal tests on GE ohuman health impacts of pesticides and there- foods and GE ingredients have been con- �? fore evaluates GE plants with altered pesti- ducted and published in the literature (See o tide traits. The EPA's regulatory oversight 40, 76, 127, 185,and 244 for reviews).In the o of Bt crops is based on the presence in the studies reported in these reviews,both chem- " plant of Cry proteins from B. thuringiensis ical analyses and studies in a variety of animals oD (See section 3.7), which are termed plant- (e.g.,dairy cows,beef cattle,pigs,laying hens, incorporated protectants (PIPs), substances broilers, fish, and rabbits) revealed no sig- Ca that alter the crop's pesticidal properties(65). nificant,unintended differences between GE Health safety assessments of GE foods are and conventional varieties in composition,di- based in part on the concept of substantial gestibility,or animal health and performance. a equivalence(132).If the food and/or its new The lack of significant differences between ingredient(s)is substantially equivalent to ex- GE food and feed and isogenic counterparts isting foods or food ingredients, it is treated in these tests strongly supports their substan- like conventional foods with respect to certain tial equivalence. aspects of its safety(124).Food or food ingre- Food safety testing in animals is used to dients used safely for long periods or foods determine toxicity and allergenicity of the substantially equivalent to these foods in nu- GE food or ingredient; however, such test- tritional characteristics do not require addi- ing of whole GE foods and feeds is difficult tonal extensive safety testing.Substances that or impossible owing to the need for animals result in scientifically based safety issues re- to consume large amounts of food to ob- quire additional testing in the laboratory or min sufficient quantities of the GE ingredient. in animal models. Compositional analyses and toxicity testing A determination of substantial equivalence of individual components are actually more requires analysis of GE foods relative to corn- sensitive and accurate in assessing safety(40). parable existing foods in terms of protein,fat, Therefore,in addition to whole foods,safety www.annualreniews.org•Issues with GE Plants and Foods 781 tests are conducted on individual products of gestion,a rapid degradation into short DNA introduced genes, both target and selectable or peptide fragments is observed in the gas- marker genes, on the basis of the food ad- trointestinal tract of animals and humans"and Transgene: a gene that is manipulated ditive provision (Section 409) of the 1992 "To date a large number of experimental stud- using recombinant Federal Food,Drug, and Cosmetic Act(83). ies with livestock have shown that rDNA frag- DNA technologies This act states that substances intentionally ments or proteins derived from GM plants and reintroduced added to food are food additives,unless they have not been detected in tissues,fluids or ed- into ghost organism are GRAS or are exempt, as with a pesti- ible products of farm animals"(68). cide, and are then the responsibility of the No reproducible data exist to show that EPA. GRAS status is established by a long transgene DNA in commercialized GE crops history of food use or when the nature of the has unique behavior relative to native plant substance does not raise significant,scientifi- DNA. However, in late 2005 Dr. Irma Er- cally based safety issues(77).For example,the makova (184) of the Russian Academy of en o F1avrSavrTm tomato(See section 2.8)was cre- Sciences publicly announced her study, de- 3 ated using a kanamycin resistance selectable scribing stunted development and higher in- ,�, marker gene; data on the selection gene and fant mortality in rats fed diets containing its product were submitted by the company Roundup Ready® soybeans (55.6% mortal- -4 and,following review,the gene and its prod- ity)compared with rats fed conventional soy- auct were granted GRAS status(188). beans(9%mortality).Among the possibilities, she claimed that animals died of mutations 2 induced solely by the transgene DNA—on 3.5.What Happens to the DNA the basis of earlier claims that DNA insertion w in Foods When They Are Eaten? in the plant genome is highly mutagenic AThe daily human intake of DNA in food is (136). Her results were not published in a N N estimated at 0.1-1 g(75).Estimates of the to- peer-reviewed scientific journal,but were pre- o CO tal daily transgene DNA intake can be cal- sented at international symposia (184) and o culated, assuming 50% of the diet is from during parliamentary debate in New South 0; GE foods and transgenes represent an esti- Wales,where the data were used to push for a mated 0.0005%of total DNA in food,as 0.5- ban on GE crop cultivation in the European y N 5 µg/day. DNA is chemically identical re- Union(E.U.)(175). gardless of its source and is mostly degraded The results of the Ermakova study con- .o during industrial processing and in the diges- tradict the results from a number of other, tive tract.Small fragments can be detected in sometimes multigenerational,studies on rats 0; certain body tissues,such as leukocytes,liver, and mice fed Roundup Ready®soybeans that and spleen.For example,fragments of orally revealed no adverse effects on litter size,his- administered phageM13 and plantDNAwere tological appearance of tissues,or numbers of taken up by phagocytes as a part of their nor- deaths of progeny(30, 231, 259;For review, mal function as immune system cells (200, see 217). Differences between these studies 201). In rare instances fragments could pass and those of Ermakova likely relate to aspects into other organs, including the fetus, but of her experimental procedure:i)the conven- were never demonstrated to be intact.Others tional diet was from an uncharacterized soy reviewing the published data in these papers variety, ii) the number of pups in the litters argued that the rare events observed more was small, and iii)reproductive rates in rats likely resulted from contamination (18, 91, fed conventional soy were low.In an attempt 120). to understand her studies, the editor of In July 2007, the European Food Safety Nature Biotechnology invited Dr.Ermakova to Authority released statements on the fate of provide a detailed account of her work(145). genes and proteins in food and feed:`After in- In this dialogue,Ermakova admits to having 782 Lemaz=x questions about her own results,making the Extensive nutritional equivalence studies need for peer-review and controlled repe- of Roundup Ready®soybeans have been con- tition of her studies using proper controls ducted.These studies include analyses of pro- essential. tein, oil, fiber, carbohydrate, ash, and mois- ture content and the amino acid and fatty acid composition in both seeds and toasted soy- 3.6.Do Genetically Engineered bean meal; the values were compared with Foods Have Changes in those from conventional soybeans. Special Nutritional Content? attention was given to levels of antinutri- Preventing adverse health effects of foods re- ents and phytonutrients typical for soybeans, quires the application of appropriate scien- e.g.,trypsin inhibitors,lectins,and isoflavones tific methods to predict and identify unin- (172).One significant difference was detected tended compositional changes resulting from in defatted, nontoasted soybean meal, the c genetic modification of plants, animals, and starting material for the production of corn- microbes--whether by classical or rDNA mercially utilized soybean protein.The vari- �, methods. It is the final product, rather than ation was in trypsin inhibitor levels, which the means by which it is modified,that is more were 11%-26% higher in GE soybeans than .75s likely to result in unintended effects (50). in wild-type.However,levels in seeds and Nonetheless, the nutritional composition of fatted,toasted soybean meal,the form used in GE foods,including levels of protein,carbo- foods, were similar for all lines. The results t hydrate,fat,vitamin,mineral,fiber,moisture, demonstrated that the composition of these and phytochemicals,is analyzed for substan- GE lines is equivalent to that of conventional 0 o tial equivalence,and levels of individual nutri- soybean cultivars in the form consumed by ' ents and antinutrients in GE foods are com- humans. Equivalence of the feeding value of pared with levels in conventional counterparts this GE soy was also demonstrated by feed- o (See section 3.4). ing it to rats, chicken, catfish, and dairy cat- o When considering substantial equiva- tle (100).A broader study using Bt corn and �M v;M lence,it is important to note that a range of Roundup Ready®corn and soybean to look at onatural variation is observed in convention- composition, digestibility, and feeding value ■' " ally bred cultivars when grown under similar for sheep,chickens,and beef and dairy cattle °= conditions (208). Therefore, comparisons of concluded that seeds of the GE varieties were nutritional content of GE foods must be mea- substantially equivalent to seeds from isolines sured against variation in conventional foods of non-GE varieties(46). grown under comparable conditions.For ex- A 1999 study of nutritional equivalence ample,nutrient composition of GE potato tu- by Lappe and others (135), often cited by bers was compared with control wild-type and those concerned about GE crops, showed tissue culture—derived non-GE potato tubers that Roundup Ready®soybeans had reduced of two cultivars, cv. Record and cv Desiree, levels of isoflavones, notably genistin and grown under the same conditions.Data were daidzin,and thus had significant implications analyzed using targeted compositional analy- for human health given the potential positive ses (207). An analysis of variance (ANOVA) health benefits of the two compounds. The for the major consensus nutrient compounds, American Soybean Association published a re- recommended by the Organization of Eco- sponse to this study indicating the variation nomic Cooperation and Development (171) in phytoestrogen levels was within the limits as being appropriate for safety assessment of of variability for conventional soybean vari- novel foods,was conducted and no consistent eties (1). In fact, not all comparisons in the differences, outside normal variation, were Lappe study of the two compounds in con- found among the tubers. ventional versus transgenic varieties showed wmm.anmurlrevir�us.oig•Issues with GE Plants and Foods 783 reduced levels; some showed significant in- Cry proteins.Full-sized Cry proteins are in- creases (128, table 1). Another phytoestro- active until eaten by target insect larva,and in- gen,glycitin,showed significant decreases in side the midgut they are cleaved and become only two of seven samples.These results un- active. The smaller, active peptides bind to derscore the variability of phytoestrogen lev- specialized receptors,creating holes in the gut els from sample to sample.A premise of the membrane that cause contents to leak and kill Lappe study(128)was that other studies on the larvae.The precision of different Bt pro- Roundup Ready® soybean used seeds from teins for their targets resides in the specificity non-herbicide-treated plants and this raised of their tight binding to companion receptors concerns on the basis of preliminary data from in the insect gut(70). Phaseolus that herbicide treatment might gen- Bt microbial products have a long history erate increased levels of phytoestrogens(198). of safe use(-40 years)with only two reports However,the original 1999 study on Roundup prior to 1995 of possible adverse human ef- n , - - - from herbicide-treated plants and no differ- Cry proteins(149).In a 1991 study that fo- ences in phytoestrogen levels were observed cused on exposure via inhalation of Bt sprays, (229). results showed immune responses and skin It is important to note that genetic engi- sensitization to Bt in 2 of 123 farm workers a 0. veering can purposefully be used to change (21).In a 2006 article,the Organic Consumers the nutritional profiles of foods.In these cases Association linked this observation to possi- o studies similar to those described above would ble impacts of Bt in GE foods,warning that 0-0 a be conducted; the mandate for substantial "Bt crops threaten public health" (38). But o w equivalence would apply only to compounds the respiratory sensitization observed in the unrelated to the introduced trait. Examples farm workers does not provide validation that a of such foods include those with increased oral exposure to Bt would result in allergic 1■1 c (3-carotene (173, 254), flavinoids (53, 189), responses. 00 calcium (174), folate (54), and iron avail- In recent years a variety of safety stud- M ability (57) (See section 2.9). According to ies were conducted specifically on native Bt FDA policy, GE foods with altered nutri- proteins to show that they do not have char- tional traits must be labeled to indicate nutri- acteristics of food allergens or toxins (See 0 el tional differences;one example is Vistivem4,a 64, 70, and 152 for reviews). In its review _ low-linoleic oil from GE soybeans that can of Bt proteins, the EPA stated that, "several a be used instead of trans fat—containing oils types of data are required for Bt plant pes- (157). ticides to provide a reasonable certainty that no harm will result from the aggregate expo- sure of these proteins."The data must show 3.7.Is the Bt Protein Safe for that Bt proteins"behave as would be expected Human Consumption? of a dietary protein, are not structurally re- Bt proteins, naturally occurring insecticides lated to any known food allergen or pro- produced by the soil bacterium,B.tburingien- tein toxin, and do not display any oral tox- sis,have been used to control crop pests since icity when administered at high doses"(64). the 1920s (89), generally as microbial prod- The EPA does not require long-term stud- ucts.Many strains of B.thuringiensis exist that ies because the protein's instability in diges- produce different Bt proteins varying in the five fluids makes such studies meaningless in insects they target, e.g., larvae of butterflies terms of consumer health(206).In vitro diges- and moths,beetles,and mosquitoes.The in- lion assays were used to confirm degradation secticidal Bt proteins form crystalline protein characteristics of Bt proteins,whereas murine bodies inside the bacterium,hence the name feeding studies were used to assess acute oral ' 784 Lomax toxicity (22, 64). Data on CrylAb in maize Moreno-Fierros study(158)referred to in the and cotton and CrylAc in tomato,maize,and press release, CrylAc was being tested as an cotton have been carefully reviewed by reg- oral adjuvant to boost vaccine titers.As such, ulatory agencies in numerous countries, in- the protein was used in large amounts and the chiding the U.S.,Canada,Japan,U.K.,E.U., stomach pH was raised to prevent degradation Russia,and South Africa(4). of CrylAc.It had been chosen as an adjuvant The possibility for allergenic effects of precisely because it is nontoxic to vertebrates four maize Bt varieties was specifically investi- (193). gated in potentially sensitive populations(16). The native Cry9c, a protein effective Skin prick tests were performed with pro- against lepidopteran insects,was engineered tein extracts from MON810,Btl1,T25,and into a variety of corn called StarlinkTM. Btl 76 and from nontransgenic control sam- Researchers knew the Cry9C protein did not pies in two sensitive groups: children with originate from an allergenic source and had �° food and inhalant allergies and individuals no amino acid homology with)mown toxins 0 with asthma-rhinitis.Irnmunoglobulin E im- or allergens in available protein databases. munoblot reactivity of sera from patients with However,when StarlinkTM corn was created, cZt food allergies was tested versus Bt maize and the Cry9C protein had no history of human pure CrylAb protein. No individual reacted dietary exposure, and in addition it was not • a differently to transgenic and nontransgenic readily digestible and was stable at 90°C 0. samples;none had detectable IgE antibodies (62),both hallmarks of certain allergens(See ,h N against pure transgenic proteins. section 3.9); Cry9C also had biochemical a A truncated version of the full-length characteristics that differentiated it from I 2 131-kDa Bt protein, containing only the other previously reviewed Cry proteins(63). -a' vi insect-toxic fragment, is used to engineer To determine with reasonable certainty that some crops.For example,Mon810 maize con- no harm would result from human exposure co o tains a truncated crylAb gene that codes for to this protein,it was necessary for the EPA to o a 91-kDa protein. The potential for maim- determine if proteins with these biochemical Mmalian toxicity of the truncated protein was characteristics were likely to affect the safety assessed by administering purified,truncated of a food. Because it was slow to digest, it -' CrylAb protein from E. coli to groups of ten provided longer lasting protection against ON male and female CD-1 mice at<4000 mg/kg insect damage, but the altered digestibility body weight (2). These doses represented a characteristics in humans and its relative ' 200-1000-fold excess over the exposure level stability to heat caused regulators to delay predicted on the basis of human consumption approval of the crop for human consumption of MON810 grain.Mice were observed up to (although it was approved for animals)so that 9 days after dosing;no treatment-related ef- they could reexamine its potential as a human fects on body weight,food consumption,sur- allergen(See section 3.9). vival,or gross pathology upon necropsy were A positive aspect of safety regarding Bt observed for mice administered CrylAb trun- corn is the lower levels of mycotoxins corn- cated protein, pared with non-Bt corn.Mycotoxins are toxic Despite extensive evaluations of Bt food and carcinogenic chemicals produced as sec- safety, in June 2005 a Greenpeace press ondary metabolites of fungal colonization release, published in the New York Times (252) that occur as a result of insects such and other international newspapers, stated, as the corn earworm carrying the mycotoxin- "There are strong warning signs that this GE containing fungi that infest the kernels Bt rice could cause allergenic reactions,as it following wounding. In some cases, the re- did when tested on mice based on a study duction of mycotoxins in Bt corn results in a (158)and references therein".However,in the positive economic impact on U.S. domestic wnno.annualreviews.org• Issues with GE Plants and Foods 785 and international markets.More importantly, have properties that indicate possible aller- in less-developed countries certain mycotox- genicity,i.e.,similarities to known allergens, ins are significant contaminants of food and small size,slow digestibility,and/or high heat their reduction in Bt corn could improve hu- stability(230).Although there are exceptions man and animal health. in each category,these characteristics indicate In 2002,APHIS announced the deregula- the protein might be allergenic and therefore tion of a corn variety,Mon 863,with increased merits further study. rootworm (Diabrotica spp.) resistance. Food One example of an introduced allergen safety assessments by the company used 90- that was forestalled by this process was the day mouse feeding trials to demonstrate safety attempt to engineer soybean with a Brazil nut (156); independent assessments also demon- protein, the methionine-rich 2S albumin, to strated the safety of Mon 863 (94, 109,228). improve soy protein's deficiency in the es- Mon 863 contains a variant Cry3Bbl with sential amino acid,methionine.Attempts to seven amino acid differences from wild-type manipulate this nutrient through traditional Cry3Bbl to enhance plant expression and in- breeding had failed because of lower yields or , secticidal activity against corn rootworm(3). grain quality.In the development of the GE A 2007 paper(203)contained a statistical re- soybean researchers recognized that allergies analysis of the original data that was differ- to nuts are among the most common types ent from the earlier risk assessment analy- of allergies and allergies specific to Brazil ses, which caused the authors to conclude nut had been documented (14). Therefore, g that"with the present data it cannot be con- testing of the new soybeans for allergenic- 0. eluded that GM corn MON 863 is a safe prod- ity was conducted in university and indus- 0 w uct." After the 2007 peer-reviewed publica- trial labs during product development. Sera o r6 don,the European Commission requested the from people allergic to Brazil nut reacted with G?N European Food Safety Authority (EFSA) to the new soybean (166), so development of c determine what impact the reanalysis had on the new soybean was halted and it was never their earlier decision. The EFSA concluded marketed. o Mthat the reanalysis did not raise new safety Foods can also be engineered to remove of- 8 concerns(67). fending allergens to create,for example,more hypoallergenic foods(See section 3.11). orsi 3.8.Have Allergens Been Introduced into Foods Through Genetic 3.9.Were Foods Made From Bt Corn Engineering? Removed from the Market Because The use of genetic engineering to introduce of Allergenicity Concerns? genes into an organism raises the possibility An example of a commercialized GE crop of the introduction of allergens. Under the that was recalled owing to concerns about al- FDA's biotechnology food policy, GE foods lergenicity is StarlinkTM corn, a variety en- must be labeled if the source of the gene is one gineered to express the Bt Czy9C protein of the common allergy-causing foods [e.g., (See section 3.7). The EPA did not approve cow's milk,eggs,fish and shellfish,tree nuts, use of StarLinkTM corn for for human con- wheat,soybeans,and especially peanuts(47)], sumption;animal consumption was approved unless the gene product is proven not to be because farm animals do not have food alter- allergenic through additional safety testing. gies. The concern was that the Cry9c pro- Although not mandatory,to date all compa- tein shared several molecular properties with nies marketing new GE foods have consulted proteins that are known food allergens(39)— with the FDA and performed recommended namely, increased heat stability and slower analyses to determine if introduced proteins digestibility characteristics.While additional 786 Lenin= testing was being conducted to determine hu- represented between 0.4-0.5% of U.S. corn man safety, StarlinkTM entered the human production (202) and levels of protein also food supply because of problems encoun- influence its potential for allergenicity(73). tered with segregating feed and food corn. StarlinkTM corn was removed from the market As a result, the FDA issued a recall of nu- in 2000 and,on the basis of USDA monitor- merous food products containing StarlinkTM ing,the food supply is now 99.99% Starlink- corn. free (242) and StarlinkTM corn therefore is In October 2000 the FDA asked the not currently likely to cause allergy-related Centers for Disease Control and Preven- problems. tion(CDCP)to investigate 51 reports of hu- man illness that individuals claimed were re- lated to consumption of products contain 3.10.Do Only Genetically ing StarlinkTM corn. Of the 51 reports, 28 Engineered Foods Cause c described symptoms consistent with a possi- Allergies? 3 ble allergic reaction to corn products.Blood Allergies are present in conventional foods serum samples from 17 patients were tested such as milk, eggs, fish, shellfish, tree nuts, using an enzyme-linked iinmunosorbent assay soybeans,wheat,and peanuts,termed the"big (ELISA) to detect antibodies to the Bt pro- eight"—the foods that are the major allergen tein. The CDCP study (3 9) concluded that sources for adults and children in the U.S.An- a StarlinkTM-specific antibodies were not de- other example of a conventionally bred food, tected in those human sera;however,the study not considered to be allergenic when intro- 0 was not conclusive for two reasons.First,food duced in the U.S.in the 1960s but now known 0 0 allergies can occur in individuals even if they to cause allergenic responses, is the kiwi e,-; have no detectable allergy-specific antibod- (Actinidia arguta).No allergenicity testing or A M ies that bind to the allergen (170). Second, screening was conducted on the fruit when the source of the protein to make antibod- introduced;however,today kiwi is known to o ies was of bacterial origin,not plant,and this cause allergic reactions (222), some of them could have changed the conformational shape lethal due to cross allergies with latex(245). cof the protein, compromising the ability of This raises the question of now much test- the antibodies to recognize the plant-made ing introduced foods,GE or classically bred, protein. However, researchers analyzed the should undergo in the U.S.before being of- *O•O corn-containing foods consumed by 10 of the fered to consumers. 17 test subjects who reported allergic reac- Given that food safety testing conducted �,; lions.Detection of Bt protein was negative in on GE foods focuses on the introduced gene 9 of 10 samples; the tenth was inconclusive and its protein product (See section 3.4), it (74) seems unlikely that allergenicity issues related Taken together,these results suggest that to a commercialized GE food that has under- the Bt protein in StarlinkTM was not involved gone FDA scrutiny will be greater than that of in the allergic reactions of the 17 individu- conventional foods,created by classical breed- als tested.But uncertainty still exists because ing and mutation, that have not undergone blood and food samples were not received such scrutiny(50).Does this mean GE foods from all 28 individuals who experienced a are 100%safe?No,a statement that a food is true allergic reaction.In separate studies, an 100% safe cannot be made about any food— EPA scientific advisory panel concluded that be it conventional,GE,or organic.For exam- the Bt in StarlinkTM had a moderate chance ple,a peanut—whether grown conventionally to cause allergies, on the basis of its bio- or organically,whether GE or non-GE—can chemical nature.But the level of its presence cause severe allergies in sensitive individuals in food at that time was low; Starlink corn (178). wwzv.annsialreviews.org•Issuer with GE Plants and Foods 787 3.11. Can Genetically Engineered It has been claimed that the 35S promoter Foods Have Fewer Allergens than may be unstable and prone to transfer and in- CaMV cauliflower Non-GE Foods? sertion into DNA of other cells, on the a- mosaic virus On the basis of data from the third National sis of a recombinational hotspot in the pro Health and Nutrition Examination Survey m ot (104). This theory led to claims that (160), 54.3% of individuals aged 6-59 had a use of the 35S and other viral promoters in positive skin test to at least one of the ten al- GE crops might increase human cancer rates lergens tested (12). The highest prevalence by activating nonviral genes in the species into was for dust mite, rye, ragweed, and cock- which it was transferred(humans)by horizon roach;approximately 25% of the population tal transfer.Although not based on direct sci- tested positive to each allergen. Peanut al- entific experimentation, Stanley Ewen, who lergy was the least common—only 9%of the collaborated with A.Pusztai on the snowdrop population—but it is one of the most severe lectin studies in potato (69), speculated that ° and durable allergies.Other food allergies in- the CaMV promoter "could affect stomach and colonic lining by causing a growth factor elude those to milk, eggs, fish,shellfish, tree effect with the unproven possibility of hasten- nuts,soybeans,and wheat(See section 3.10). The nature of the proteins causing these al- ing cancer formation in those organs (212). lergic reactions is well characterized in cer- These speculations have been extensively fain cases, thus making it is possible to en- rebutted by the scientific community,as sum- �- gineer the organism to make lower levels of rnarized in 105.One major thrust of the rebut- ti the proteins responsible for the allergies or tals is that the 35S promoter is ubiquitous in 0 ai nature. In the U.K. an estimated 14-25% a change their conformation to reduce allergic 0 0 of oilseed rape in the field is infected with 2 w responses(33).Reported successful examples - of engineering approaches that reduce alter CaMV(101); similar numbers have been es A M timated for cauliflower and cabbage.Because •N genicity include those aimed at grass pollen °°° (24,25)and foods such as wheat(34,35),rice of its prevalence in foods,humans have con ° (224),and peanuts(Arachis hypogaea)(219). sumed CaMV and its promoter at high levels nu o4 M for decades with no observable effects.The i c° presence of the CaMV promoter in GE plants No~ does not in principle present a different situ- -7 3.12.Do Viral Sequences Used ation. Additionall y' DNA in food is rapidly T in Plant Genetic Engineering broken down during digestion,giving it little Create a Human Health Risk? time to interact with the stomach and colonic Introduced transgenes are regulated by pro- linings(See section 3.5). moter sequences that determine how much, A documented issue with this promoter where, and when the encoded protein is in the laboratory is that it can become in- expressed. The 35S promoter from the activated if CaMV infects the GE plant with cauliflower mosaic virus (CaMV) (168) was a CaMV-driven transgene. This inactivation used in some commercial GE crops, e.g., was demonstrated when CaMV-driven herbi- Bt11, Bt176, Mon810 maize, and Roundup cide resistance in oilseed rape was compro- Ready®soybean(4).This promoter was used mised, causing the virally infected plants to to obtain strong expression of the linked gene become susceptible to the herbicide (5). Al- throughout the plant(19).In other GE crops though not related to human safety,this situa- such as high laurate canola,a native promoter tion should be carefully monitored in the field (Brassica napin storage protein promoter)led to avoid unexpected situations. At present to expression of the California laurel(Umbel- other promoters that are not derived from lularia californica)thioesterase in embryos,but plant viruses are being used in GE plants(45, not in leaves or pollen(187). 183,247). 788 Lesnanx 3.13. Can Genetically Engineered ing DNA is fragmented into small pieces.To Foods Increase Antibiotic Resistance demonstrate the fate of transgene DNA in hu- in Human and Animal Intestinal mans,the antibiotic resistance gene from GE Flora? maize was shown not to transfer to gut bacte- The frequency of resistance to antibiotics in ria in chickens fed GE maize(48). bacteria and the numbers of drugs to which Although GE crops are not likely to be they are resistant is increasing.Several factors significant factors in increasing the incidence have been suggested as exacerbating this prob of antibiotic-resistant bacteria,new selection lem(163).One potential causative factor is the strategies for identifying engineered plants widespread use of antibiotics in human they were developed,in part as a response to pub- apy(90,119).Another potential causative fac- tor is the subtherapeutic use of antibiotics for the use of antibiotic resistance genes as se ,� growth promotion in farm animals(41, 138 lectable markers. These approaches include ° 216).In a 2007 report on levels of antibiotics genes such as phosphomannose and xylose in the manure of animals fed antibiotics,data isomerase that facilitate selection by giving transgenic cells a metabolic advantage over were presented on the passage of antibiotics to foods,especially root crops,when manure nontransgenic cells (180). Also, means exist to segregate marker genes so they do not re- was used as fertilizer(56).This is of potential importance to all fanners who utilize animal main in the commercial product(128, 258). o manure as a primary source of fertilizer. An Agrobacteriun-mediated method is avail- ° Antibiotic resistance genes—sometimes able that uses plant-derived transfer DNA and O a novel transient selection system that can re- v used as markers to identify GE plant cells -a 0 ° that receive tansgenes—might add to the salt in only native DNA in GE plants(194). o problem of antibiotic-resistant bacteria. 3.14.Can Genetically Engineered For marker genes in GE foods to increase y - • antibiotic resistance in humans or animals, Food Crops Be Used to Make ° they must be transferred to bacteria in Pharmaceuticals? Could They the respective digestive tracts. Functional Contaminate the Food Supply? oci o transfer of plant DNA into microorganisms In the early 1990s,efforts were made to eval- o N is directly impacted by intactness of DNA. uate the effectiveness of plants and foods to Complete transfer of the antibiotic resistance deliver pharmaceuticals,particularly vaccines. gene, and possibly its controlling elements, These efforts involved using tobacco to ex- a and its integration in the bacterial chro- press a bacterial surface protein to prevent x mosome must occur to make a bacterium dental caries and to express the hepatitis B antibiotic-resistant. surface antigen(52, 147). Since then, maize, During chewing, cells in food are broken potato,rice, soybean, and tomato have been down.As cells are destroyed,DNA is released used to produce vaccines for both humans and highly active enzymes in saliva and in the and animals(177).These include subunit vac- plant start degrading DNA(153)—a process cines against pneumonic and bubonic plague, that continues in the digestive tract, where shown to be immunogenic in mice (6); a other enzymes further break down DNA and potato-based vaccine for hepatitis B that raises proteins(See section 3.5). In mouse studies, an immunological response in humans(233); fragments but not intact pieces of M13mp18 a GE pollen vaccine that reduces symptoms DNA were found in 0.1%of white blood cells in allergy sufferers(164);and an edible rice- and spleen or liver cells at 2-24 h after feeding, based vaccine targeted to allergic diseases such but not later(201).In humans,foods remain as asthma,seasonal allergies, and atopic der- in the stomach for^2 h,where the remain- mantis(225)(See section 2.9). www.annaalrevirus.org•Issues with GE Plants and Foods 789 Plant vaccines have the advantage of be- the FDA released a guidance document that ing readily consumed with limited or no recommends multiple strategies to prevent processing and of obviating the need for pharma crops from contaminating human or cold storage, clear advantages in developing animal feed(79).This document suggests that countries. However, with this ease of deliv- those who are growing drug-producing plants ery comes the possibility that such products that cross pollinate, such as corn and canola, could enter the food supply if food crops strengthen containment procedures by grow- are engineered.Under U.S.regulations, GE ing plants in geographical regions where little plants containing pharmaceutical or indus- or none of that crop is grown for food.Fol- trial products are not permitted to enter the lowing this strategy,Ventria, a company that food supply.The FDA prohibits"adulterated" developed self-pollinating rice engineered to foods in the supply chain, including foods produce human lysostaphin and lysozyme to from GE crops that might contain poten- shorten the duration of childhood diarrhea, o tially harmful proteins (81). APHIS, which relocated their fields from their home rice- regulates the movement and field testing of growing state, California, to Kansas, where GE plants (See section 3.6), requires special commercial rice is not grown(87). 5 steps to prevent plants that produce drugs "o or industrial enzymes from contaminating 3.15.Why Doesn't the FDA food crops: i) labeling, packaging, and seg- regating regulated plant materials;ii)repro Require Labeling of Genetically w° a ductive isolation to prevent GE pollen from Engineered Foods? fertilizing conventional plants; iii) posthar- The FDA's labeling policy for GE foods is L.0 74 vest monitoring to remove volunteer plants; the same as for conventional foods and it oand (iv) proper disposal of the transgenic assures that consumers are given informa- A n material. tion about nutritional,health safety, or food o In 2005 these rules were tightened to in- quality changes in the end product. FDA- .. g r- dude the following: i) exclude field growth mandated labels are not used to provide infor- M without a permit;ii)include crop inspections mation about the process by which the food oseven times/year, twice after harvest; iii)in- is made.If a GE food is significantly different crease field isolation distances; and iv) use from its conventional counterpart, the food 0 CV dedicated farm equipment(9).This tighten- must be labeled to indicate the difference.In- ing resulted from early violations of field- stances where the nutritional profile changes testing permits. For example, in two cases are included, for example if the GE food is regulators found volunteer engineered corn created using genetic information from a pre- plants producing a pharmaceutical protein(8) viously recognized allergenic source,such as that had tassled in a soybean field. peanut,soy,or wheat,or if the new protein has Cases like these demonstrate that"pharm- characteristics of known allergens.For exam- ing"in food plants can result in mixing with ple, oils made from GE soybean and canola food. The Grocery Manufacturers of Amer- varieties with changes in fatty acid composi- ica urged the USDA to restrict plant-made tion must be labeled;foods containing those pharmaceutical production to nonfood crops oils must be labeled and companies produc- (96). The National Corn Growers Associa- ing that oil must use a new name.For example, tion countered by proposing safeguards such Monsanto is using the name Vistiveml to mar- as i)using plants that are male-sterile or that ket its low—linoleic acid product from GE soy- produce non-GE pollen, ii) dedicated pro- bean oils(157).If a food contains a new po- duction systems that isolate pharma crops, tentially allergy-causing introduced protein, iii) third-party verification, and iv) grower the label must state that the product contains training programs(159).In September 2002, the allergen and name its source. 790 Lernaux 3.16.Are Organic Foods Healthier a limited number of metabolites for a few or Safer? foods grown under differing environmental Organic farming is a method of agricultural conditions using conventional and organic production that does not allow the use of production systems,more research is required synthetic pesticides,fertilizers,or growth en- to determine if any of these differences have hancers.Foods grown under organic certifica- tion differ from conventionally produced food pies of such studies follow. by the manner in which they are grown,han- i. Zarb and colleagues (260) looked died, and processed, but an "organic" label at the profiles of 44 metabolites in does not guarantee the nature of the product, wheat grown under comparable or- the food, or ingredient, only its production ganic and conventional conditions as a method.The important factors for many peo- part of a long-term biodynamic,bioor- ple who consume organic foods relate to the ganic, and conventional farming sys- ° perceptions that they are healthier,taste bet tern in Switzerland. Statistical analyses ter,are better for the environment,have lower of data,obtained with high-throughput pesticide levels and fewer food additives,and gas chromatography-mass spectrome- are better for animal welfare(214).However, try, showed that metabolite status of c organic certification does not imply that foods wheat grain from organic and conven- yproduced using organic methods are more nu- tional farming did not differ in the lev- e— tritious or safer than those produced without els of 44 metabolites, which indicates organic methods(195). low or no impact of farming systems on i a A 2007 review by the British Nutrition wheat metabolite composition. w° Foundation stated, `There appears to be a ii. Another study found increases in vita- „.-; perception among many consumers that or- min C in organically grown kiwifruit A N ganic foods are more nutritious and there- compared with conventionally grown co a fore healthier than conventionally produced fruits, both before and after storage. N,° foods.However,to date there are limited data Postharvest performance was measured Into support this view” (248).This perception for both types of kiwifruit, grown on o...-1 has led in part to increases in the world mar- the same farm and harvested at the same (NI o N ket for certified organic foods to —$34 bil- maturity stage(7). Total phenolics and ca>, lion in 2005 (111).A 2007 poll showed that antioxidant activity were also higher in l''O 57% of polled consumers strongly believed organic fruit. o. that science had proven that organic food was iii. In tomatoes, levels of the flavonoids x healthier than conventional (182, figure 17). quercitin and kaempferol aglycones in Because of the paucity of scientific data, the archived samples of organically pro- UK Food Standards Agency decided in Octo- duced tomatoes, grown from 1994- her 2007 to seek a contractor who will evaluate 2004 in the Long-Term Research on relevant studies and compare the nutrient and Agricultural Systems project at Univer- non-nutrient content of organic and conven- sity of California,Davis,were at statis- tional foods to determine if any compositional tically higher levels than those grown in differences have nutritional or other health ef- the same tract using conventional pro- fects in the context of the complete diet(86). duction practices (155). Flavonoid lev- In general, only a small number of peer- els increased over time in the toma- reviewed studies exist that analyze nutritional toes grown organically,but not in those differences between foods produced conven- grown conventionally. tionally and organically.Although statistically iv. Increases in total antioxidant activity significant differences have been observed for were also found in a 2005 study of red www.annnalreviews.org•Imes with GE Plants and Foods 791 oranges(Citrus anrantiurn).Organic or- iii. A 2007 study conducted on 312 breast- anges had significantly higher total phe- feeding mothers demonstrated that nolics, total anthocyanins and ascorbic mothers'milk from women eating a diet acid levels, and total antioxidant activ- that consisted of 89% or more of or- ityversus corresponding nonorganic or- ganic dairy and meat products was mea- anges (227). Four lots of fruits, pur- curably higher in conjugated linoleic chased from certified producers grown acid(192). under statutory European Community iv. Kuhnert and coworkers (131) looked regulations at the same time of year, at the incidence of E. coli, particularly were analyzed;however, no assurances Shiga toxigenic and 0157:H7 strains, were given that the two sources of or- in milk.Although levels were relatively anges were grown under comparable high in cattle feces, no differences in environmental conditions.Also,no in- prevalence of the two types of organisms c dications of the natural variation in in milk were found between those raised these phytonutrients were given for using organic practices versus conven- tt, comparison. tional farming systems. av. There are"moderately strong and con- Differences reported in nutrient composi- sistent data showing that organic pota- non between organically and conventionally '5) toes are richer sources of vitamin C than their conventionally grown coun- produced foods are interesting but,as seen in o the examples given,it is very difficult to con- terparts";no studies have shown lower trol all variables that might affect nutritional levels of vitamin C in organic potatoes 0.°) quality and ensure that the observed variations w° (248)' are significant and reproducible.In addition, o Several studies of nutritional differences be there are many important nutrients for which A N tweet organically and conventionally pro no significant differences have been found. 00 c0 duced dairy products have been reported. For example,in milk no significant differences i. Several small-scale studies reported have been reported in other major nutrients 06• tn sc different conclusions when compar- such as calcium,zinc,vitamin B2, or vitamin ing the effects of farming systems B12 (248).Much more research is needed to • N on the content in milk of conju- determine whether the nutritional differences F° >-, gated linoleic acid content, known for observed between organic and conventional its health-promoting effects (cited in food products are reproducible and have a sig- 60). nificant impact on human health. °" In one large-scale study a higher pro- One notable difference between conven- portion of polyunsaturated fatty acids tional and organic production methods,which and n-3 fatty acids relative to mono- may be perceived by consumers as health- unsaturated fatty acids was observed ier, is the ban on the use of synthetic pes- in milk from cows raised under or- ticides in organic agriculture. Synthetic pes- ganic production methods, compared ticides can only be used in organic farming with those that were conventionally when an efficacious, natural version is not raised (60). No differences were seen available and no organic substitutes exist.Lists in the proportion of conjugated linoleic of chemicals approved for organic agricul- acid or vaccenic acid,but factors other tore are available (162). With regard to this than farming systems,e.g.,time of year, aspect of food safety of organics, very little breed,type of feed,and access to fresh peer-reviewed research has been conducted. grazing, are known to affect the fatty A small-scale study looked at levels of cer- acid content of milk. tain pesticides in children's urine following 792 Lcmaa' consumption of conventional and organic ically complex world comes with risks. The foods.Researchers looked at contributions of introduction of the automobile,hybrid crops, daily dietary pesticide intake on overall pes- margarine,pasteurized milk,and vaccines all ticide exposure during a 15-day period in 23 came with attendant risks.Only after individ- children, aged 3-11 (142).Children ate con- uals gained experience with these new prod- ventional foods on days 1-3 and 9-15 and ucts did they become comfortable with choos- organic foods on days 4-8; attempts were ing those products for which the benefits for made to substitute comparable food items so them outweighed the risks. as not to change their diets.Analysis of urine The first GE crops to be released commer- specimens collected twice daily showed that cially benefited farmers, the companies that concentrations of the organophosphate pes- produced them, and in some cases the envi- ticides malathion and chlorpyrifos decreased ronment,but consumers saw little benefit.In to undetectable levels immediately after or- the development pipeline are GE crops and ganic diets were consumed and remained un- foods that might be attractive to consumers detectable until conventional diets resumed. and have greater benefit for the environment , However, no direct determinations of levels (See section 2.9), but benefits realized de- of organophosphates in the foods were carried pend on which products are developed,how out and it was not stated whether the already they are deployed,and how different individ- low levels of organophosphates in the con- uals value them. Potential advantages from ventional foods would have adverse impacts GE crops and foods could be substantial in o o on health. terms of the environment and human health. Strictly from a nutritional perspective not In fact,continuing to deplete our resources as c° enough data exist at present to show nutri- we do now is likely to be more harmful than tional benefits from conventionally or organ- making the best possible use of all available • ically produced foods that favors consuming technologies(31). o,c either for health benefits.However,if the goal The second factor relating to acceptance of is to promote healthy eating,it is more im- GE food has to do with assurance of safety.GE ,64 M portant for consumers to focus on eating a foods that make it to the market go through c healthy,balanced diet,rich in fruits and veg- extensive safety testing,the data from which "'~ etables,than focusing on foods that are pro- are reviewed by the USDA,FDA,and/or EPA ori duced by particular methods.Convincing epi- (See sections 2.6 and 3.4).GE foods cannot be demiological evidence shows that diets rich guaranteed to be 100%safe,just as foods cre- °+ in fresh fruits and vegetables, regardless of ated by conventional breeding or grown using � the methods used to produce them,improve conventional or organic practices cannot be health and are associated with reduced fre- guaranteed to be completely safe(15).Given quency and severity of a number of health that safety testing of GE foods focuses on the conditions(191). introduced gene and its product and a de- termination of substantial equivalence, food safety issues with a commercialized GE food 3.17.Should Genetically Engineered that are greater than those experienced with Crops and Foods Be Banned Until conventionally modified foods are unlikely to They Are Proven to Be 100%Safe? arise(50). Acceptance of the new GE foods depends on The third factor relating to acceptance several factors, including perception of risk of GE foods has to do with individual val- and benefit,assurance of safety,and one's own ues. This aspect cannot he addressed with values.Nearly everything in our technolog- scientific data. www.atuntalreviews.org•Issues with GE Plants and Foods 793 3.18.Are Milk and Meat from sumption of those products from their non- Cloned Cows Safe to Eat? clone counterparts"(80). bGH: bovine A clone of an organism is genetically identi- growth hormone cal to a single common ancestor. Cloning of TGF-T: insulin-like animals can be achieved by splitting an early- 3.19.Is Milk from rbGH-Injected growth factor I stage multicellular embryo to create twins; Cows Safe?Why Isn't It Labeled? rbGH: recombinant the first split-embryo calves were produced Bovine growth hormone (bGH), also called bovine growth in 1981.Clones are also produced by nuclear bovine somatotropin (bST), is unrelated to hormone transfer,in which DNA from the nucleus of steroid hormones.bGH,produced in the pi- one cell is introduced into a recipient unfertil- tuitary glands of dairy cows,is a naturally oc- ized egg from which the nucleus was removed curring protein hormone in milk,which stim- (223). Nuclear transfer has been performed ulates the liver to produce insulin-like growth ,D successfully since the mid-1980s, but Dolly factor-I(IGF-I).The structure of human so- "8° sheep was different—she represented the matotropin differs from bGH, and the lat- first successful nuclear transfer to an adult ter is not biologically active in humans(176). cell (249). Since then, several adult tissues Upon pasteurization, 90% of bGH is de- have been used to produce clones of cattle, stroyed; digestive enzymes degrade the re- •a pigs,horses,cats,rabbits,goats,and fish(59). mainder. Other growth factors in milk(e.g., Cloning animals is one of many methods used the cytokines IL-1 and IL-2),though some- 6-- to assist animal reproduction(154). times slightly elevated in milk. from bGH- 6;1 o One of the food safety issues raised re- injected cows,are inactive in other mammals a garding consumption of food from cloned an- (122). c w° imals is whether the process causes changes Since the late 1920s it was known that o in the composition of food derived from the lactating mammals produce more milk when • A M N animal. The Center of Veterinary Medicine treated with extracts of the pituitary hormone co c in the FDA has the responsibility to evalu- bGH,but because that hormone could only be • ° ate food safety and animal health issues. In isolated from the pituitary glands of slaugh- their draft risk assessment of the safety of food tered cattle, bGH was not available in suf- o from cloned animals, they state it is "highly ficient quantities for commercial use in the o N unlikely that `silent' pathways producing in- dairy industry(37).Sufficient quantities were trinsic toxicants exist in food animals" and made available when a synthetic gene for hGH • A that the only hazards that could arise"would was inserted into a bacterium to produce re- be from incomplete or inappropriate repro- combinant bGH (rbGH or rbST), which is gramming of the genetic information from chemically identical to bGH. When rbGH the donor somatic nucleus(i.e.,epigenetic ef- is injected into cows, the efficiency of con- fects)"(80).With regard to compositional dif- version of feed to milk is increased and milk ferences in meat from cloned cows,numerous yields can be increased by 15% to 20% (17, studies found no obvious differences in milk or 55). Trace amounts of bGH is found in all meat(167,226,235,236,246).The FDA draft milk;cows given rbGH contain no more bGH risk assessment on livestock cloning states, than unsupplemented cows (122). Published "the current weight of evidence suggests that data indicate that the use of rbGH to increase there are no biological reasons, either based milk production does not impact its nutri- on underlying scientific assumptions or em- tional quality pirical studies, to indicate that consumption Extensive studies of rbGH safety have been of edible products from clones of cattle,pigs, conducted worldwide and reviewed by the sheep or goats poses a greater risk than con- FDA, after which both milk and meat from 794 LOmanx rbGH-injected cows were deemed safe(78). January 2008,the Pennsylvania Department Separate reviews of the data by the National of Agriculture issued a new labeling standard Institutes of Health,the World Health Orga- indicating that milk could be labeled as com- nization,the Office of the Inspector General ing from cows not treated with rbGH as long of the Department of Health and Human Ser- as the labeling was uniform(179). vices,and reviews by the Journal of the Amer- Outside the U.S.,countries that are signa- ican Medical Association and the Journal of tories to the World Trade Organization can- the American Dietetic Association all inde- not bar milk from cows injected with rbGH pendently concluded that milk from rbGH- based solely on its production method, un- injected cows is safe. less there is scientific evidence that it affects Despite these safety assurances, claims human health or safety (37). But the E.U. were made as recently as 2001 (66)that milk has been staunch in its opposition to such from rbGH-treated cows contains elevated milk in part due to consumer concerns that c levels of IGF-I,a protein hormone normally arose in the 1990s as a result of certain food present in milk(44).An elevated content of safety outbreaks, such as bovine spongiform , IGF-I has been suggested to have adverse encephalopathy(32),that were not effectively implications for human health and cancer handled by existing regulatory systems. In 2 frequency.Comparisons of marketed milk in- 1999 the E.U.decided not to approve sales of dicate that there are no differences in IGF- milk from rbGH-treated cows in E.U.mem- I concentrations between milk derived from ber countries,based not on human health con- ocows treated or not with rbGH (240), and cerns but on animal welfare issues(51).Today alevels are within the limits of natural varia- milk and milk products from rbGH-treated o w lion(for review,see 85).In fact,IGF-I levels cows are recognized as safe in the E.U. and in human breast milk and saliva are higher can be marketed in E.U. countries (49, 97), •N than in cow's milk.Additionally,IGF-I is di- but the use of rbST in their dairy herds is not gested as other food proteins are and is inac- approved. o five when consumed(for review,see 85).IGF- With regard to animal health,some studies MI content of milk from rbGH-treated cows has have reported an increased frequency of mas- cbeen extensively reviewed and its safety con- tiffs in groups of rbGH-treated cows. This firmed(78,97,240). increase has been attributed mainly to in- -;cd 0 N The FDA concluded that the use of rbGH creased milk volume in the mammary glands in dairy cattle presents no confirmed health of treated cows and no convincing data are risks to consumers and the milk is substan- available that show a decrease in secretion C4 tially equivalent to milk from cows not treated of mammary gland immune factors as a re- with rbGH(See section 3.4).However,aside suit of growth hormone treatments (36). A from safety issues, some consumers view the 1999 study(106)indicated the rbGH can ac- use of rbGH to increase milk production as tually provide a protective effect against Strep- "unnatural"and this has been promoted as a tococcus uheris mastitis following experimental reason to oppose milk from cows injected with infection. rbGH(37).This perspective led some dairies to voluntarily,although not legally,label milk as being from cows not injected with rbGH, 3.20. Can the USDA Stop the even though FDA labeling policy for foods Planting of Genetically Engineered produced from GE ingredients(which is the Crops that Pose Health or same as for all other foods and food ingre- Risks? dients)specifies no label is needed if the food After the commercialization process for a GE is substantially equivalent to non-GE foods in crop is complete, including deregulation, all safety,composition,and nutrition.Of note,in federal regulatory agencies (FDA, EPA, and www.annwab eviews.og•lulus with GE Plants and Foods 795 USDA) have the legal authority to demand become blind each year; half of them die the immediate removal of any product from within twelve months (250). Recent studies Bioavailabili the marketplace. Removal can be demanded indicate that biofortification,i.e.,incorporat- e if new,science-based evidence raises questions ing micronutrients into food, has the poten- degree to or rate at which substance is about consumer or environmental safety(10). tial to control deficiencies and is cost-effective absorbed and A case in point is the rescinding of deregu- and efficient compared with alternative public becomes available for latory status of Roundup Ready®alfalfa by a health and agricultural measures when eon- physiological activity U.S.District Court Judge in 2007,on the ba- pled with other micronutrient interventions Recommended sis of the lack of a full EIS (112).A concern (220). To develop a biofortification strategy daily allowance was that cultivation of GE alfalfa would result to address vitamin A deficiency, researchers (RDA): amounts of vitamins and in the spread of the Roundup Ready® gene developed the first variety of Golden Rice minerals to be to"natural alfalfa"causing a"significant en- (GRI),a GE variety with increased levels of 13- consumed to vironmental impact" (121). After a specified carotene,a precursor to vitamin A,compared o maintain good date in 2007, farmers were not able to plant with non-GE rice (254). The rice contained health,specified by Roundup Ready®alfalfa and will have to await three new genes,two from daffodil(Narcissus the Food and Nutrition Board of more evaluation and approval of the EIS. pseudonarcissus)and one from a bacterium(Er- the National winia uredovora).In 2005 the development of a Research Council new Golden Rice variety GR23 was published; 0 3.21.Is Golden Rice the Only Way in GR2 a maize gene is substituted for the to Provide Vitamin A to People daffodil genes, boosting (3-carotene levels to 0 o in Developing Countries? 37 µg/g—estimated to provide 50% of a ""r2 Vitamin A deficiency,along with iron and zinc child's RDA of vitamin A in 72 g of dry deficiencies, pose the greatest public health GR2 rice (173).However, the actual impact ovi consequences of all micronutrient deficien- of this rice also depends on several other vari- A cies.Vitamin A deficiency is most common in ables, e.g.,uptake and conversion to vitamin 00 o young children and pregnant women and can A, amount consumed, bioavailability, effects o lead to blindness, susceptibility to infectious of cooking,and consumer acceptance(28). v;M diseases,and death(251).The Food and Agri- The GR1 and GR2 rice varieties are in ocultural Organization and the United Nations use in breeding programs in the Philippines, have developed different strategies to over- India, Bangladesh, China, and Vietnam; the 0 CI come deficiency of vitamin A, including di- use of Golden Rice is being governed by _p etary diversification,food fortification,and vi- the Golden Rice Humanitarian Board and is ° tamin supplementation.When applied,there based on full regulatory compliance(G.Berry, t;; has been varying success in different regions personal communication).Although perhaps of the developing world with the various ap- not legally needed,because often no intellec- proaches,e.g.,distribution of vitamin A pills tual property restrictions exist in these coun- in Nepal(241),the fortification of sugar with tries on commonly employed genes[e.g.,35S vitamin A in Guatemala(13), and gardening promoter, hygromycin resistance gene (26)], projects in Bangladesh and Thailand(239).All all companies with patents applying to Golden these efforts required continuous public ed- Rice licensed them at no charge for use in ucation and financial support from the pub- resource-poor countries. lic and private sector. For example, vitamin Golden Rice might increase vitamin A suf- A fortification of sugar was temporarily sus- ficiency for people in areas difficult to reach pended owing to an economic downturn that with other vitamin A distribution efforts or increased vitamin A prices and at that point for people with limited opportunities to grow vitamin A deficiency reappeared(239). or purchase sufficient amounts of fresh veg- Despite these various efforts, 250,000 etables or fruits. Golden Rice will not be to 500,000 children deficient in vitamin A the single solution to vitamin A deficiency 796 Lemaux worldwide,but it is another tool that can be tory agencies have,in general,proceeded with used in public health programs to combat vi- caution in releasing GE varieties. Although tamin A deficiency no human activity can be guaranteed 100% safe,the commercial GE crops and products 4.CONCLUDING REMARKS available today are at least as safe in terms of food safety as those produced by conventional Researchers using rDNA methods now have methods.This does not mean we should relax the technology to transfer genes, not only our vigilance in investigating products result- within a species,but also from one kingdom ing from this new technology as well as the to another.This technology opens the door to time-honored methods. But, we should not changing agricultural crops in ways not pre- hold the new GE products to standards not viously possible.These changes can result in required for food and feed products produced plants that are better able to survive pest at- by other technologies and methods. o tack and abiotic stresses,can be enhanced nu- With the proper balance of caution and tritionally, or can be used to immunize hu- scrutiny,we can take advantage of the power mans and animals.But,with this capacity to of this technology without compromising the change comes the responsibility to proceed health of humans, animals, or the environ- swith caution,investigating possible outcomes ment.To achieve that proper balance it is im- Ncarefully. Conversely, there is also a respon- portant to know the facts about the technol- sibility to utilize the technology where it can ogy and its products.This is the information oprovide improvements to human health and that I have attempted to provide in Part I of c the environment and make farmers' efforts this review on general and food issues.In Part o more productive. II,I will cover environmental and socioeco- On the basis of the intensive look at the nomic issues.In this way, paraphrasing Car- • data and the peer-reviewed research in this dinal Wolsey,I hope that this will help us to ;,o review,the development of GE crops to date be "very,very careful what we put into our Mseems to have been responsible and regula- heads"! a;"1 op b o n SUMMARY POINTS g N 1. Foods consumed today are derived from plants and animals whose genetic makeup otl has been modified by sexual crosses and mutation.Recombinant DNA provides a new tool to make genetic modifications,and this technology is termed genetic engineering c(, or biotechnology. 2. Technically,researchers are now able to transfer genes using recombinant DNA meth- ods,not only within a species,but also from one kingdom to another,which can lead to significant changes in various attributes of agricultural crops. 3. The safety of genetically engineered crops and foods,just as those created by classical breeding and mutation and grown conventionally or organically,needs to be evaluated on a case-by-case basis so that informed decisions can be made about their utility, safety,and appropriateness. 4. Data and information from peer-reviewed science on the safety of these products should be a part of the information considered when growing and consuming foods from these crops. 5. Factors beyond the technical,science-based facts should also be considered during the decision-making process. www.annrm[reviews.org•Issues with GE Plants and Foods 797 6. Although scientific testing and governmental regulation can reduce the safety risks of conventionally and organically produced and genetically engineered crops and food, 100%safety is not achievable. 7. To date,no scientifically valid demonstrations have shown that food safety issues of foods containing genetically engineered(GE)ingredients are greater than those from conventionally or organically produced foods. 8. In commercial fields only a few crops have been modified using rDNA technolo- gies (i.e., canola, corn, cotton, papaya, squash, and soy), but many others are in development. 0 0 FUTURE ISSUES 1. The introduction of pharmaceutical and industrial proteins into edible genetically engineered crops raises issues that require additional safety and regulatory scrutiny. •a 2. Measures that permit farmers to use their production techniques of choice, while 0. respecting their neighbors'rights to do the same,must be pursued to achieve economic coexistence. o o 3. Interest in and funding for independent peer-reviewed studies on the food safety of 0 o conventional,organic,and GE foods must be encouraged. o- 4. Rigorous, fact-based governmental regulatory policy should be in place to allow •N public-and private-sector scientists to play a role in the creation and evaluation of o genetically engineered crops. o �M V'I M 06 DISCLOSURE STATEMENT TThe author is not aware of any biases that might be perceived as affecting the objectivity of this review. c4' ACKNOWLEDGMENTS The author thanks Dr. Wilhelm Gruissem for encouragment fifteen years ago to begin the process of addressing the issues related to agricultural biotechnology in a scholarly manner, linking responses to the peer-reviewed scientific literature.The author also expresses gratitude to Dr.Petra Baettig-Frey for providing the first draft of these efforts—available for the past ten years in the biotechnology information section of http://ucbiotech.org. The author is also indebted to the dedication of Ms.Barbara Alonso,who helped in the preparation of this manuscript and has maintained a scientific database that made the writing of this article possible. LITERATURE CITED 1. Ag BioTech InfoNet. 1999. ASA response to: `Alterations in clinically important phytoestrogens in genetically modified, herbicide-tolerant soybeans." http://wwwbiotech- info.net/ASAsesponse.html 798 Lemaux 2. AGBIOS. 2005. Database Product Description: MON-00810-6 (MON810). http:// www agbios.com/dbase.php?actionnShowProd&data=MON810&frmac=LONG 3. AGBIOS. 2006. Database Product Description: MON-00863-5 (MON863). httpi/ www.agbios.com/dbase.php?action=ShowProd&data=MON863&frmat=LONG 4. AGBIOS. 2007. GM Crop Database Product Description. http://agbios.com/ dbase.php. 4.Database for querying safety 5. Al-KaffNS,Kreike MM,Covey SN,Pitcher R,Page AM,Dale PJ.2000.Plants rendered information on herbicide-susceptible by cauliflower mosaic virus-elicited suppression of a 35S promoter genetically regulated transgene.Nat.Biotechnol. 18:995-99 engineered plants 6. Alvarez ML, Pinyerd HL, Crisantes JD,Rigano MM, Pinkhasov J, et al. 2006. Plant- and plants with made subunit vaccine against pneumonic and bubonic plague is orally immunogenic in novel traits mice. Vaccine 24:2477-90 produced using accelerated 7. Amodio ML,Colelli G,Hasey JK,Kader AA.2007.A comparative study of composition mutagenesis and and postharvest performance of organically and conventionally grown kiwifruits.J. Sci. plant breeding. 3 Food Agric. 87:1228-36 8. Animal Plant Health Insp.Serv.,USDA.2002.USDA Investigates Biotech Company for Pos- sihle Permit Violations.http://www.aphis.usda.gov/Ipa/news/2002/11/prodigene.html 9. Animal Plant Health Insp.Serv.,USDA.2005.Introductions of plants genetically engi- o neered to produce industrial compounds.Docket No.03-038-2.Fed.Regist. 70:85 10. Animal Plant Health Insp.Serv.,USDA.2005.USDA's biotechnology deregulation pro- cess.http://www.aphis.usda.gov/Ipa/pubs/fsheet_faq_notice/fs_biodereg.html -g 11. Animal Plant Health Insp.Serv.,USDA.2007.Return to regulated status of alfalfa ge- V oc netically engineered for tolerance to the herbicide glyphosate.Fed.Regist. 72:56 3 12. Arbes SJ Jr, Gergen PJ, Elliott L, Zeldin DC. 2005. Prevalences of positive skin test A M responses to 10 common allergens in the US population:Results from the Third National ;7, Health and Nutrition Examination Survey.J.Allergy Clin.Immunol. 116:377-83 13. Arroyave G,Aguilar JR,Flores M,Guzman MA.1995.Fortification of sugar with vitamin A. UN Univ. 192(Chapter 7):1-82 14. Arshad SH,Malmberg E,Krapf K,Hide DW. 1991.Clinical and immunological char- 06.0 acteristics of Brazil nut allergy. Clin.Exp.Allergy 21:373-76 o N 15. Avery AA.2006.The Truth about Organic Foods.Chesterfield,MO:Henderson Commun. al 16. Batista R, Nunes B, Carmo M, Cardoso C,Jose HS, et al. 2005. Lack of detectable allergenicity of transgenic maize and soya samples.J.Allergy Glitz.Inzmunol. 116:403-10 17. Bauman DE,Eppared PJ,DeGeeter MJ,Lanza GM.1985.Responses of high-producing c'14 dairy cows to long-term treatment with pituitary somatotropin and recombinant soma- totropin.J Dairy Sci.68:1352-62 18. Beever DE,Kemp CF.2000.Safety issues associated with the DNA in animal feed derived from genetically modified crops.A review of scientific and regulatory procedures.Mar. Abstr.Rev.Ser.B:Livestock Feeds Feed. 70:175-82 19. Benfey PN,Chua N-H. 1990.The Cauliflower Mosaic Virus 35S promoter:Combina- torial regulation of transcription in plants.Science 250:959-66 20. Berberich SA,Ream JE,Jackson TL,Wood R,Stipanovic R,et al.1996.The composition of insect-protected cottonseed is equivalent to that of conventional cottonseed.J.Agric. Food Chem.44:365-71 21. Bernstein L, Bernstein JA,Miller M, Tierzieva S, Bernstein DI, et al. 1999.Immune responses in farm workers after exposure to Bacillus thuringiensis pesticides.Environ.Health Perspect. 107:575-82 22. Betz FS,Hammond BF,Fuchs RL.2000.Safety and advantages of Bacillus thm ingiensis protected plants to control insect pests.Regul.Toxicol.Pharmacol.32:156-73 www.annua!eriews.org•Issues with GE Plants and Foods 799 23. Bevan MW,Flavell RB, Chilton MD. 1983.A chimeric antibiotic resistance gene as a selectable marker for plant cell transformation.Nature 304:184-87 24. Bhalla PL, Singh MB. 2004.Knocking out expression of plant allergen genes.Methods 32:340-45 25. Bhalla PL, Swoboda I, Singh MB. 2001. Reduction in allergenicity of grass pollen by genetic engineering.Int.Arch.Allergy Immunol. 124:51-54 26. Binenbaum E,Nottenburg C,Pardey PG,Wright BD,Zambrano P.2000.South-north trade,intellectual property jurisdictions,and Freedom to Operate in agricultural research on staple crops.Environ.Prod.Technol.Div.,Int.Food Policy Res.Inst.Discuss.Pap.No.70 27. Bioteelmol. Ind. Organ. (BIO). 2007. Guide to Biotechnology 2007, p. 83. http://bio. org/speeches/pubs/er/BiotechGuide.pdf 28. Bouis H.2004.Hidden hunger.the role of nutrition,fortification and biofortification.Presented at World Food Prize Int.Symp.,Des Moines,IA O 29. Bouquet A,Marck G,Pistagna D,Torregrosa L.2003.Transfer of grape fanleaf virus coat protein gene through hybridization with Xiphinema index resistant genotypes to obtain root- stocks resistant to virus spread.Presented at VIII Int.Conf.Grape Genet.Breed.,Int.Soc. Horticult.Sci.,Acta Horticult.603:325-36 30. Brake DG, Evenson DP. 2004. A generational study of glyphosate-tolerant soybeans on mouse fetal,postnatal,pubertal and adult testicular development.Food Chem. Toxicol. 42:29-36 o 31. Brown LR,Renner M,Halweil B.2000. Vital Signs 2000.New York/London:Norton. • a. 191 pp. ed • ° 32. Brown P, Will RG, Bradley R, Asher DM, Detwiler L. 2001. Bovine spongiform o encephalopathy and variant Creutzfeldt Jakob disease: Background, evolution and A M current concerns. Emerg. Infect. Dis. 7(1)Jan-Feb. http://wwwedc.gov/ncidod/EID/ • N N o vol7no1/brown.htm 0 33. Buchanan BB.2001.Genetic engineering and the allergy issue.PlantPhysiol. 126:5-7 r v;M 34. Buchanan BB,Adamidi C,Lozano RM,Yee BC,Momma M,et al. 1997.Thioredoxin- o^ linked mitigation of allergic responses to wheat.Proc.Natl.Acad.Sci. USA 94:5372-77 o. 35. Buchanan BB, del Val G, Frick OL. 1999. Thioredoxin: A photosynthetic regztlatory in protein mitigating food allergies. Am. Soc. Plant Biol. Annu. Meet., Abstr. 42002. http://abstracts.aspb.org/pb1999/public/M20/0952.shtml 36. Burton JL, McBride BW, Block E, Glimm DR, Kennelly JJ. 1994. A review of 36.Review of safety studies on effects bovine growth hormone.Can.J.Anim. Sci. 74:167-201 of long-term rBST 37. Buttel FH.2004.The recombinant BGH controversy in the United States:Toward a new treatment of cows. consumption politics of food?Agric.Hum. Values 17:5-20 38. Carman NJ. 2006. Gene-altered Bt crops threaten public health:Immune responses and skin sensitization to Bt in faum workers and presence of Bt in many genetically engineered foods. http://www.organicconsumers.org/ge/BT031706.cfm 40.Provides 39. Cent. Dis. Control Prey. 2001. CDC report to FDA: Investigation of human scientific information and health effects associated with potential exposure to genetically modified corn. tune 11. recommendations http://www.cdc.gov/nceh/ehhe/Cry9cReport/pdfs/cry9creport.pdf on safety and 40. Chassy B,Hlywka JJ,Kleter GA,Kok EJ,Kuiper HA,et al.2004.Nutritional and nutritional aspects safety assessments of foods and feeds nutritionally improved through biotechnol- crops with ogy:An executive summary.Compr.Rev.Food Sci.Food Sal:3:25-104 i mproved nutritional 41. Chee-Sanford JC,Aminov RI,Krapac IJ,Garrigues-Jeanjean N,Mackie RI.2001.Occur- qualities. rence and diversity of tetracycline resistance genes in lagoons and groundwater underlying two swine production facilities.Appl.Environ.Microbiol. 67:1494-502 Boo Lenraux 42. Chetelat RT, Deverna JW, Bennett AB. 1995. Introgression into tomato (Lycopersicon esculentum)of the L.chmielewskii sucrose accumulator gene(ma)controlling fruit sugar composition.Tbeor.Appl.Genet.91:327-33 43. Cho M-J,Kim HK,Choi H-W,Buchanan BB,Lemaux PG.2000.Endosperm-specific GFP expression driven by barley D-hordein promoter and its inheritance in transgenic barley and wheat plants.In Vitro Cell.Dev.Biol.Anim. 36:A63 44. Chopra S,Feeley M,Lambert G,Mueller T.1998.rBST(Nutrilac)"Gaps Analysis."Report. Health Prot.Branch,Health Can.http://www.nfu.ca/gapsreport.html 45. Christensen AH, Quail PH. 1996.Ubiquitin promoter-based vectors for high-level ex- pression of selectable and/or screenable marker genes in monocotyledonous plants.T rans- genic Res. 5:213-18 46. Clark JH, Ipharraguerre IR. 2001. Livestock performance: Feeding Biotech Crops.3. Dairy Sci. 84:E9-18 47. Clydessdale FM.1996.Allergenicity of foods produced by genetic modification.Food Sci. Nutr. 36:1-186 .2 48. Coghlan A.2000.So far so good-For the moment,the gene genie is staying in its bottle. New Sci. 165:4 49. Collier RJ,Bauman DE.2001.Re:Re:Role of the insulin-like growth factors in cancer c development and progression.3.Natl. Cancer Inst. 93:876 50. Comm. Identifying Assessing Unintended Effects Genet. Eng. Foods Human Health. a 2004.Safety of Genetically Engineered Foods:Approaches toAssessing Unintended Health Effects. Washington,DC:Natl.Acad. o "0 51. Counc. Decis. 17 Dec. 1999. Concerning the placing on the market and ad- -4 u' ministration of bovine somatotrophin (BST) and repealing decision 90/218/EEC o"1 q M 1999/880/EC.Off 3 Eat:Communities 42:71-73 http://eurlex.europa.eu/LexUriServ/ csi LexUriServ.do?uri=OJ:L:1999:331:0071:0072:EN:PDF 52. Curtiss RI III,Cardineau CA.1990.Genetically modified plants for use as oral immuno- ° gens.World Patent Appl. WO 90/02484 o53. Deavours BE, Dixon RA. 2005. Metabolic engineering of isoflavonoid biosynthesis in alfalfa.Plant Physiol. 138:2245-59 o v 54. Diaz de Is Garza RI,Gregory JF III,Hanson AD.2007.Folate biofortification of tomato fruit.Proc.Natl.Acad.Sc,. USA 104:4218-22 55. Dohoo IR,Leslie K,DesCoteaux L,Fredeen A,Dowling P,et al.2003.A meta-analysis review of the effects of rBST 1.Methodology and effects on production.Can.1. Vet.Res. '4 67:241-51 56. Dolliver H,Kumar K, Gupta S. 2007. Sulfamethazine uptake by plants from manure- amended soil.3.Environ. Q. 36:1224-30 57. Drakakaki G,Marcel S,Glahn RP,Lund EK,Pariagh S,et al.2005.Endosperm-specific coexpression of recombinant soybean ferritin and Aspergillus phytase in maize results in significant increases in the levels of bioavailable iron.Plant Mol.Biol. 59:869-80 58. Dubcovsky J. 2004. Marker-assisted selection in public breeding programs: the wheat experience.Crop Sci.44:1895-98 59. Edwards JL, Schrick FN,McCracken MD,van Amstel SR, Hopkins FM, et al. 2003. Cloning adult farm animals:A review of the possibilities and problems associated with somatic cell nuclear transfer.Am.] Repr-od.Immunol. 50:113-23 60. Ellis KA,Innocent G,Grove-White D,Cripps P,McLean WG,et al.2006.Comparing the fatty acid composition of organic and conventional milk.J.Dairy Sci.89:1938-50 61. Ellstrand NC. 2006. Genetic Eng. Pollen Flow. Univ. Calif. Agric. Nat. Resour., Agric. Genet.Eng.Fact Sheet 5.Agric.Biotechnol.Calif.Ser.,Publ.8182 www.annualreviews.org•Issues with GE Plants and Foods Sot 62. Environ. Prot. Agency (EPA). 1998. Bacillus thuringiensis subspecies tolworthi Cry9C protein and the genetic material necessary for its production in corn;Exemption from the requirement of a tolerance.Fed.Regist. 63(99):28258-61 63. Environ. Prot. Agency (EPA). 2007. Cry9C food allergenicily assessment background document. http://www epa.gov/oppbppol/biopesticides/pips/old/cry9c/cry9c-epa- background.htm 64. Environ.Prot.Agency Off.Pestic.Programs Biopesticides Pollut.Prey.Div.2000.Biopes- ticides registration document,preliminary risks and benefits section,Bacillus thuringiensis plant- pesticides.Washington,DC:EPA 65. Environ.Prot.Agency Off.Sci.Coord.Policy Biotechnol.Team.2006.Regulatory frame- work.http://www.epa.gov/scipoly/biotech/pubs/framework.htrn 66. Epstein SS. 2001. Role of the insulin-like growth factors in cancer development and progression.J.Natl. Cancer Inst. 93:238 0 67. Eur.Food Sal Auth.2007.EFSA review of stathtical analyses conducted for the assessment of the MON 863 90-day rat feeding study. http://www.efsa.europa.eu/EFSA/efsalocale- 0 1178620753812A178621342614.hun a 68. Eur. Food Saf. Auth. 2007. EFSA statement of the fate of recombinant DNA or 1 c proteins in meat, milk and eggs from animals. http://www efsa.europa.eu/EFSA/ Statement/gmoEFSA_statement_DNA_proteins_gastroint,0.pdf 69. Ewen SWB, Pusztai A. 1999. Effect of diets containing genetically modified pota- > w `o toes expressing Galantbus nivalis lectin on rat small intestine. Lancet 354:1353- Q. 54 o w 70. Federici B. 2002. Case study: Bt crops a novel mode of insect control. In Geneti- c cally Modified Crops:Assessing Safety, ed. KT Atherton, pp. 164-200. London: Taylor A N &Francis co CD 71. Fernandez-Cornejo J,Caswell M.2006.The first decade of genetically engineered crops ° in the United States. USDA Econ.Res.Serv.,Econ.Inf. Bull.No.EIB-11 72. Fierobe HP,Mingardon F,Mechaly A, Belaich A, Rincon MT, et al. 2005.Action of 06 designer cellulosomes on homogeneous versus complex substrates: controlled incorpo eN . ration of three distinct enzymes into a defined trifunctional scaffoldin.J. Biol. Chem. 280:16325-34 73. FIFRA Sci. Advis. Panel Meet. 2000. A set of scientific issues being considered by the Environmental Protection Agency regarding: Assessment of Scientifu:Information Con- cerning StarLinkT' Corn. SAP Rep. No. 2000-06, Dec. 1. http://www.agbios.com/ docroot/articles/2000341-A.pdf 74. FIFRA Sci. Advisory Panel Meet. 2001. A Set of Scientific Issues Being Considered by the Environmental Protection Agency Regarding: Assessment of Additional Scientific Information Concerning StarLinkT1 Corn. SAP Rep. No. 2001-09, July 25. http:// www.epa.gov/scipoly/sap/meetings/2001/index.htrnitjuly 75. Flachowsky G.2007.Feeds from genetically engineeringplants-Results and future chal- lenges.ISB News Rep.March:4-7 76. Flachowsky G,Aulrich K, Bohme H, Halle I. 2007. Studies on feeds from genetically modified plants (GMP)-Contributions to nutritional and safety assessment; Table 3. Anima.Feed Sci. Technol 133:2-30 77. Food Drug Adm. (FDA). 1995. FDA'S policy for foods developed by biotechnology. http://vm.cfsan.fda.govhArd/biopolcy.html 78. Food Drug Adm.(FDA).2000.FDA responds to citizen petition on BST.FDA Vet.Newsl. XV:8.http://www.fda.gov/cvm/CVM_Updates/cpetup.html 802 Lernaux 79. Food Drug Adm. (FDA). 2002. Guidance for industry: Drugs, biologics, and medical devices derived from bioengineered plants for use in humans and animals. httpi/www. fda.gov/cber/gdlns/bioplant.htm 80. Food Drug Adm. (FDA). 2003. Animal cloning: A risk assessment. http://www. fda.gov/cvm/Documents/CLRAES.pdf 81. Food Drug Adm.(FDA).2004.Federal Food, Drug, and Cosmetic Act: Chapter IV-Food. http://www.fda.gov/opacom/laws/fdcact/fdcact4.htm 82. Food Drug Adm. (FDA). 2005. Guidance for industry:Pharmacogenomic data submissions. http://www.fda.gov/Cder/guidance/6400fril.pdf 83. Food Drug Adm. Cent. Food Saf. Appl. Nutr. 1996. Safety assurance of foods derived by modern biotechnology in the United States.http://www.cfsan.fda.govi,Ard/biojap96.html 84. Food Drug Adm. Cent. Food Saf. Appl. Nutr. 2007. Biotechnology. http://vm. cfsan.fda.gov/%7E1yd/biotechm.html 0 85. Food Drug Adm. Cent. Vet. Med. 1993. Report on the Food and Drug Admin- istration's Review of the Safety of Recombinant Bovine Somatotropin. http://www.fda. gov/cvm/RBRPTFNL.htm 86. Food Standards Agency. 2007. Agency seeks contractor to review scientific literature. http://www food.gov uk/news/newsarchive/2007/oct/contractorliterature cj 87. Fox JL.2006.Turning plants into factories.Nat.Bioteehnol.24:1191-93 88. Gaba V,Zelcer A, Gal-On A. 2004. Cucurbit biotechnology-the importance of virus 6 resistance.In Vitro Cell.Dev.Biol.Plant 40:346-58 89. Glazer AN,Nikaido H.1995.Microbial Biotechnology:Fundamentals of Applied Microbiology. o a co New York:Freeman 90. Gold HS, Moellering RC Jr. 1996. Antimicrobial-drug resistance. N. Engl.3. Med. Q M 335:1445-53 N N oo 0 91. Goldstein DA,Tinland B,Gilbertson LA, Staub JM,Bannon GA, et al.2005.Human r M safety and genetically modified plants:a review of antibiotic resistance markers and future v;M transformation selection technologies.3.Appl.Microbiol. 99:7-23 o 92. Gonsalves D. 1998.Control of papaya ringspot virus in papaya:A case study.Anon.Rev. Pbytopathol. 36:165-205 od gra 93. Gonsalves D, Ferriera S, Manshardt R, Fitch M, Slightom J. 2000. Transgenic virus _a resistant Papaya:New hope for controlling Papaya Ringspot Virus in Hawaii.Plant Health Progress. (plant Health. Reviews),21 June a 94. Grant RJ,Fanning KC,Kleinschmit D,Stanisiewski EP,Harwell GF.2003.Influence of glyphosate-tolerant(event NK603)and corn rootworm protected(event MON863)corn silage and grain on feed consumption and milk production in Holstein cattle.3. Dairy Sci. 89:1707-15 95. Green ML,Angal S,Lowe PA,Marston FAO.1985.Cheddar cheesemaking with recom- binant calf chymosin(EC 3.4.23.4)synthesized in Escberichia coli.3. Dairy Res. 52:281- 86 96. Grocery Manuf. Am. 2002. GMA urges the use of non-food crops for biotech drugs: ProdiGene's errors raise serious concerns, say GMA. http://www.gmabrands.com/news/ docs/NewsRelease.cfm?DocID 1029 97. Haligaard P,Gaspard I,Abraam D.1999.No need for maximum residue limit for risk-free BST,says commission.Brussels Belgium.La Prensa 1999:954 98. Hallman WK, Hebden WC,Aquino HL, Cutie CL, Lang JT. 2003. Public Perceptions of Genetically Modified Foods:A National Study of American Knowledge and Opinion. Food Policy Inst.Publ.RR-1003-004.New Brunswick,NJ:Rutgers Univ. www.a:nnalrr'iews.or,•Laster with GE Plants and Foods 8o3 99. Hammond BG, Campbell KW,Pilcher CD, Degooyer TA, Robinson AE,et al. 2004. Lower fumonisin mycotoxin levels in the grain of Bt-corn grown in the United States in 2000-2002.J.Agric.Food Chem. 52:1390-97 100. Hammond BG,Vicini JL,Hartnell GF,Naylor MW,Knight CD,et al.1996.The feeding value of soybeans fed to rats,chickens,catfish and dairy cattle is not altered by genetic incorporation of glyphosate tolerance.J.Nutr: 126:717-27 101. Hardwick NV,Davies JML,Wright DM. 1994.The incidence of three virus diseases of winter oilseed rape in England and Wales in the 1991/02 and 1992/93 growing season. Plant Patbol.43:1045-49 102. Hellsten I.2003.Focus on metaphors:The case of Frankenfood on the Web.J. Cmnput.- Med. Commun. 8(4) 103. Hightower R,Baden C,Penzes E,Lund P,Dunsmuir P. 1991.Expression of antifreeze proteins in transgenic plants.Plant Mol.Biol. 17:1013-21 104. Ho M-W,Ryan A, Cummins J. 1999.Cauliflower mosaic viral promoter--A recipe for 3 disaster?Microb.Ecol.Health Dis. 11:194-97 ��, 105. Hodgson J.2000.Scientists avert new GMO crisis.Nat.Biotechnol. 18:13 5 106. Hoeben D,Burvenich D,Eppard PJ,Hard DL.1999.Effect of rBST on milk production and composition of cows with Streptococcus uberis mastitis.3.Dairy Sci. 82:1671-83 107. Horvath Z. 2003. Damage in corn production and in hybrid multiplication caused by species of Coleoptera. Cereal Res. Commun. 31:421-27 108. Hyten DL,Hartman GL,Nelson RL,Frederick RD, Concibido VC, et al. 2007.Map O. location of the Rppl locus that confers resistance to soybean rust in soybean. Crop Sci. o w 47:837-40 109. Hyun Y, Bressner GE, Fischer RL, Miller PS, Ellis M, et al. 2005. Performance of A M growing-finishing pigs fed diets containing YieldGard Rootworm corn (MON 863), N N 03= a nontransgenic genetically similar corn, or conventional corn hybrids.J. Anim. Sri. M 83:1581-90 °."'• 110. Insp. Gen. USDA. 2005.Audit Report:Animal Plant Health Inspect. Serv. Controls over cIssuance of Genet.Eng. Organism Release Permits.Audit 50601-8-Te '" 111. Int.Fed. Org.Agric.Mov. (IFOANI).2007.Nearly 31 Million Certified Organic Hectares co' Worldwide:IFOAM, FiBL and SOL present new facts and figures about the organic sector at ° BioFach 2007.httpJ/www.ifoam.org/press/press/Statistics.2007.htm1 a 112. IPSA. 2007. Federal judge rules USDA approval of RR alfalfa illegal.Independent Prof. c° Seed Assoc.Newsl. 5:6-7 113. ISB (Inf. Syst. Biotechnol.). 2007. Petitions of nonregulated status granted or pending by APHIS.http://www.aphis.usda.gov/brs/not_reg.html 114. ISB(Inf.Syst.Biotechnol.).2007.Search results fir tomato,field test release permits database for the U.S. http://www.isb.vt.edu/CFDOCS/fieldtests3.cfm?FfELDNAME NUM VAL,LISTAS,SELECTASCDESC,DB_CHOICE&numsa 91-079-01r& Comprehensive db_choice=com&lista detail&select_ascdesc sort_date review of current 115. Iyer-Pascuzzi AS,McCouch SR. 2007. Functional markers for xa5-mediated resistance status of acreage of in rice.Mol.Breed. 19:291-96 genetically 116.James C.2005.Global status of commercialized biotech/GM crops:2005.ISAAA engineered crops Brigs No.34 grown worldwide. 117. James C.2006.Global status of commercialized biotech/GM crops:2006.ISAAA Briefs No.35 118. James S,Burton M.2003. Consumer preferences for GM food and other attributes of the food system.Aust.J.Agric.Res.Econ.47:501-18 804 Lemanx 119. Jeljaszewicz J,Mlynarczyk G,Mlynarczyk A.2000.Antibiotic resistance in grain-positive cocci.Int.J.Antimicrob.Agents 16:473-78 120. Jonas DA,Elmadfa I,Engel KH,Heller KJ,Kozianowski G,et al.2001.Safety consid- erations of DNA in food.Ann.Nutr.Metabol.45:235-54 121. Jones P.2007.Judge concerned that alfalfa may be a little rascal-and other legal news. ISB News Rep.July 2007:9-10 122. Juskevich JC,Guyer CG.1990.Bovine growth hormone:Human food safety evaluation. Science 249:875-84 123. Kahle K,Kraus M,Richling E.2005.Polyphenol profiles of apple juices.Mol.Nutr.Food Res.49:797-806 124. Kessler DA,Taylor MR,Maryanski JH,Flamm EL,Kahl LS. 1992.The safety of foods developed by biotechnology.Science 256:1747-49 125. Klibanov AM. 1989. Advances in enzymes. In Biotechnology Challenges in the Flavor and q Food Industry,ed.RD Lindsay,BJ Willis,pp.25-43.New York:Elsevier Appl.Sci. 126. Kong FN,WangJY,Zou JC,Shi LX,Jin MD,et al.2007.Molecular tagging and mapping of the erect panicle gene in rice.Mol.Breed. 19:297-304 127. Konig A, Cockburn A,Crevel RWR,Debruyne E,Grafstroem R,et al.2004.As- 127.Provides - ° sessment of the safety of foods derived from genetically modified(GM)crops.Food guidance on how to a Chem. Toxicol.42:1047-88 assess the safety of o 128. Koprek T,McElroy D,Louwerse J,Williams Carrier R,Lemaux PG.2000.An efficient foods derived from w o method for dispersing Ds elements in the barley genome as a tool for determining gene genetically ' ° function.Plant]. 24:253-63 engineered crops. 4° 129. Kramer MG, Redenbaugh K. 1994. Commercialization of a tomato with an antisense AM polygalacturonase gene-the Flaw Saw-r story.Euphytica 9:293-97 130. Ku MS, Cho D,Li X,Jiao DM,Pinto M, et al. 2001.Introduction of genes encoding 17:- o C4 photosynthesis enzymes into rice plants:Physiological consequences.Novartis Found, ^M Symp.,Rice Biotechnol.:Improv. Yield,Stress Toler: Grain Qual 236:100-11 oM cc;e 131. Kuhnert P,Cubosson DR,Roesch M,Homeld E,Doherr MG,Blum JW.2005.Preva- lence and risk-factor analysis of Shiga toxigenic E.tali in faecal samples of organically and o N conventionally farmed dairy cattle. Vet.Microbial. 109:3 7-45 132. Kuiper HA,Kleter GA,Noteborn HPJM,Kok EJ.2001.Assessment of the food safety issues related to genetically modified foods.Plant].27:503-28 133. Kuiper HA,Noteborn HPJM,Peijnenburg AACM.1999.Adequacy of methods for test- (:°4 ing the safety of genetically modified foods.Lancet 354:1315-16 134. Lachman A. 1999.GM food debate.Lancet 354:1726 135. Lappe MA, Bailey EB, Childress C, Setchell KDR. 1999. Alterations in clinically im- portant phytoestrogens in genetically modified,herbicide tolerant soybeans.].Med.Food 1:241-45 136. Latham JR,Wilson AK,Steinbrecher RA.2005.Mutational consequences of plant trans- formation..Blamed.Biotech. 2006:1-7 137. Lee J,Cetiner MS,Blackmon WJ,Jaynes JM. 1990.The reduction of the freezing point of tobacco plants transformed with the gene encoding for the antifreeze protein from winter flounder.]. Cell.Biochem.Suppl. 14(Pt.E):303 138. Levy SB. 1998.Multidrug resistance:a sign of the times.N.Engl.J.Med. 338:1376-78 139. Lewis P.1992.Mutant foods create risks we can't yet guess.The New York Times,June 16 140. Liu F-X,Tan Z-B,Zhu J-Q,Deng X-J.2004.Arabidopsis CBF1 in plant tolerance to low temperature and drought stresses.H Chuan 26:394-98(In Chinese) wurm.annualrr,iews,org•Imes with GE Plants and Foodr 805 141. Lius S, Manshardt RM, Fitch MMM, Slightom JL, Sanford JC, Gonsalves D. 1997. Pathogen-derived resistance provides papaya with effective protection against papaya ringspot virus.Mol.Breed. 3:161-68 142. Lu C, Toepel K, Irish R, Fenske RA, Barr DB, Bravo R. 2005. Organic diets signifi- cantly lower children's dietary exposure to organophosphorus pesticides.Environ.Health Perspect. 114:260-63 143. Macer DRJ. 2003. Genetic engineering: Cross species and cross cultural perspectives, Table 2.In Dialog der Kulturen,ed.S Fritsch-Oppermann,pp.159-80.Loccum:Evange- lische Akad. 144. Manning R. 2004. Super organics. Wired, May, Issue 1205. http://wwwwired. com/wired/archive/12.05/food.html 145. Marshall A. 2007. GM soybeans and health safety-a controversy reexamined. Nat. Biotechnol.25:981-87 146. Martineau B.2001.First Fruit:The Creation of the Flaw Saw Tomato and the Birth 146.Historical on the perspective of Biotech Foods.New York:McGraw-Hill p challenges faced by 147. Mason HS, Lam DM,Arntzen CJ. 1992. Expression of hepatitis B surface antigen in the first genetically transgenic plants.Proc.Natl.Acad.Sci. USA 89:11745-49 engineered whole 148. Mayeno AN,Gleich GJ. 1994.Eosinophilia-myalgia syndrome and tryptophan produc- 0 food. don:A cautionary tale. Tends Biotechnol. 12:346-52 E ; 149. McClintock JT,Schaffer CR,Sjoblad RD.1995.A comparative review of the mammalian toxicity of Bacillus thuringiensis-based pesticides.Pectic.Sci.45:95-105 Q ° 150. McHughen A.2006.Plant Genetic Engineering and Regulation in the U.S.Univ.Calif.Agric. aNat.Resour.,Agric.Biotechnol.Calif.Ser.,Publ.8179 o e w° 151. Melis A,Happe T.2001.Hydrogen production.Green algae as a source of energy.Plant o rn Physiol. 127:740-48 •N 152. Mendelsohn M,Kough J,Vaituzis Z,Matthews K.2003.Are Bt crops safe?Nat.Biotechnol. 0° 21:1003-9 o 153. Mercer DK,Scott KP,Bruce Johnson WA,Glover A,Flint HJ.1999.Fate of free DNA v;M and transformation of the oral bacterium Streptococcus gordonii DL1 by plasmid DNA in human saliva.Appl.Environ.Microbiol. 65:6-10 o N 154. Mirando MA, Hamernik DL. 2006. Funding priorities in animal reproduction at the i:a USDA Coop.State Res.Educ.Ext.Serv.Biol.Reprod. 74:459-62 '° 155. Mitchell AE,Hong Y-J,Koh E,Barrett DM,Bryant DE,et al.2007.Ten-year comparison ° of the influence of organic and conventional crop management practices on the content of flavonoids in tomatoes./Agric.Food Chem. 55:6154-59 156. Monsanto. 2003. Safety Assessment of YieldGard RootwormTM Corn. http://www. monsanto.com/pdf/products/yieldgardv_es.pdf 157. Monsanto. 2007. VistiveTM brochure. http://www.monsanto.com/monsanto/ag_ products/pdf/output_traits/vistive_full_brochure.pdf 158. Moreno-Fierros L,Garcia N,Gutierrez R,Lopez-Revilla R,Vazquez-Padron RI.2000. Intranasal,rectal and intraperitoneal immunization with protoxin CrylAc from Bacillus thuringiensis induces compartmentalized serum, intestinal,vaginal and pulmonary im- mune responses in Balb/c mice.Microbes Infect.2:885-90 159. Natl.Corn Growers Assoc.2002.NCGA commends APHIS on quick action concerning biotech compliance infractions.http://wvvw.ncga.com/news/notd/2002/november/112702.htm 160. Nail. Health Nutr. Exam. Sure. III. 2004. Training manual fir allergy component. httpi/www.cdc.gov/nchs/data/nhanes/nhanes3/cdrom/nchs/manuals/train.pdf 161. Natl. Org. Program (NOP). 2006. NOP regulations and guidelines. http://www.ams. usda.gov/nop/NOP/NOPhome.html 8o6 Lrnraux 162. Natl. Org. Program (NOP). 2007. National List Information. http://wwwams.usda. gov/nop/NationalList/ListHome.html 163. Nawaz MS,Erickson BD,Khan AA,Khan SA,Pothuluri JV,et al.2001.Human health impact and regulatory issues involving antimicrobial resistance in the food animal pro- duction environment.Regal.Res.Perspect. 1:1-10 164. Niederberger V,Horak F,Vrtala S, Spitzauer S,Krauth M-T,et al. 2004.Vaccination with genetically engineered allergens prevents progression of allergic disease.Proc.Natl. Acad.Sci. USA 101:14677-82 165. Nocente F, Gazza L, Pasquini M. 2007. Evaluation of leaf rust resistance genes LrI, Lr9,Lr24,Lr47 and their introgression into common wheat cultivars by marker-assisted selection.Enphytica 155:329-36 166. Nordlee JA,Taylor SL,Townsend JA,Thomas LA,Bush RK. 1996.Identification of a Brazil-nut allergen in transgenic soybeans.N.Engl.J.Med. 334:688-92 0 167. Norman HD,Walsh MK. 2004. Performance of dairy cattle clones and evaluation of their milk composition.Cloning Stem Cells 6:157-64 168. Odell JT,Nagy F,Chua N-H.1985.Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter.Nature 313:810-14 ? 181. Perkins JB,Sloma A,Hermann T,TheriaultK,Zachgo E,et al.1999.Genetic engineering of Bacillus subtilis for the commercial production of riboflavin.3.Ind.Microbiol.Biotechnol. 22:8-18 182. Pirog R, Larson A. 2007. Consumer perceptions of the safety, health and environmen- tal impacts of various scales and geographic origin of food supply chains. http://www. leopold.iastate.edu/pubs/staff/consumer/consumer_0907.pdf 183. Potenza C, Aleman L, Sengupta-Gopalan C. 2004. Targeting transgene expression in research,agricultural and environmental applications:Promoters used in plant transfor- mation.In Vitro Cell.Dev.Biol.40:1-22 184. Pravda(Online).2005.People eating genetically modified food may have rat-short lifespan,Nov. 27.http://english.pravda.ru/science/19/94/377/16372_GMF.html 185.Extensive 185. Preston C.2005.Peer reviewed publications on safety of GM foods.AgBioWorld. bo listing of httpJ/www.agbioworld.org/biotech-info/articles/biotech-art/peer-reviewed-pubs. peer-reviewed html fA ,, publications on 186. R. Soc. 1999. Review of data on possible toxicity of GM potatoes, May 18. http:// food safety of royalsociety.org/displaypagedoc.asp?id=6170 genetically 187. Radke SE,Andrews BM,Moloney MM,Crouch ML,Kridl JC,Knauf VC. 1988.Trans- engineered foods. a formation of Brassica napes L.using Agrobacterium tumefaciens:developmentally regulated yexpression of a reintroduced napin gene. Theor.Appl. Genet. 75:685-94 o 188. Redenbaugh K,Hiatt W,Martineau B,Kramer M,Sheehy R,et al.1992.Safety Assessment of Genetically Engineered Fruits and Vegetables:A Case Study of the FLAVR SAVR Tomato. aBoca Raton,FL:CRC Press.267 pp. 189. Rein D, Schijlen E, Kooistra T, Herbers K, Verschuren L, et al. 2006. Transgenic 0= flavonoid tomato intake reduces C-reactive protein in human C-reactive protein trans- A est genic mice more than wild-type tomato.3.Nute: 136:2331-37 190. Ribaut J-M,Ragot M. 2007.MAS to improve drought adaptation in maize.3.Exp.Bot. 58:351-60 cc; 191. Riboli E,Norat T. 2003. Epidemiologic evidence of the protective effect of fruit and o vegetables on cancer risk.Am.3. Clin.Nutr 78:S559-69 o N 192. Rist L,Mueller A, Barthel C, Snijders B,Jansen M, et al. 2007. Influence of organic diet on the amount of conjugated linoleic acids in breast milk of lactating women in the Netherlands.Br.3.Nutr 97:735--43 193. Rojas-Hernandez S, Rodriguez-Monroy MA, Lopez-Revilla R, Resendiz-Albor AA, Moreno-Fierros L.2004.Intranasal coadministration of the Cryl Ac protoxin with amoe- bal Q9 lysates increases protection against Naegleria fowleri meningoencephalitis.Infect.Im- mun. 72:4368-75 194. Rommens CM, Humara JM, Ye J, Yan H, Richael C, et al. 2004. Crop improvement through modification of the plant's own genome.Plant Physiol. 135:1-11 195. Ronald P,Fouche B.2006.Genetic Engineering and Organic Production Systems.Univ.Calif. Div.Agric.Nat.Resour.,Agric.Biotechnol.Calif.Ser.,Publ.8188 196. Rossi M,Goggin FL,Milligan SB,Kaloshian I,Ullman DE,Williamson VM.1998.The nematode resistance gene Mi of tomato confers resistance against the potato aphid.Proc. Natl.Acad.Sci. USA 95:9750-54 197. Roufs JB.1992.Review of L-tryptophan and eosinophilia-mylagia syndrome.3.Am.Diet. Assoc.92:844-50 198. Sandermann H,Wellmann E. 1998.Risikobewertung der kunstlichen herbizidresistenz. Biol.Sichesheit 1:285-92 8o8 Lenin's 199. Schilling BJ,Hallman WK,Adelaja AO,Marxen LJ. 2002. Consumer Knowledge of Food Biotechnology:A Descriptive Study of U.S.Residents.Food Policy Inst.Rep.RR-0602-002. New Brunswick,NJ:Rutgers Univ. 200. Schubbert R, Hohlweg U, Renz D, Doerfler W. 1998. On the fate of orally ingested foreign DNA in mice:chromosomal association and placental transmission in the fetus. Mol. Gen. Genet.259:569-76 201. Schubbert R,Renz B,Schmitz B,Doerfler W. 1997. Foreign(M13)DNA ingested by mice reaches peripheral leukocytes, spleen,and liver via the intestinal wall mucosa and can be covalently linked to mouse DNA.Proc.Natl.Acad.Sci. USA 94:961-66 202. Segarra AE,Rawson JM.2001.StarlinkTm Corn Controversy:Background. CRC Report for Congress RS20732.http://ncseonline.org/NLE/CRSreports/Agriculture/ag-101.cfm 203. Seralini GE,Cellier D,de Vendomois JS.2007.New analysis of a rat feeding study with a genetically modified maize reveals signs of hepatorenal toxicity.Arch.Environ. Contain. Toxicol. 52:596-602 204. Sharma DR,Kaur R,Kumar K.1996.Embryo rescue in plants-a review.Euphytica 89:325- .5 37 a 205. Sheen TF,Wang HL,Wang DN. 1998.Control of papaya ringspot virus by cross pro- tection and cultivation techniques.J.Jpn.Soc.Hortticult.Sci.67:1232-35 206. Shelton AM, Zhao J-Z,Roush RT. 2002.Economic, ecological,food safety and social o consequences of the deployment of Bt transgenic plants.Anna.Rev.Entomol.47:845-81 207. Shepherd LVT, McNicol JAY, Razzo R, Taylor MA, Davies HV. 2006. Assess- 207 o o ing potential for unintended effects in genetically modified potatoes perturbed in Demonstration of • w metabolic and developmental processes. Targeted analysis of key nutrients and substantial o� A r, antinutrients. Transgenic Res. 15:409-25 equivalence of key •N 208. Shewry PR, Baudo M, Lovegrove A, Powers S, Napiera JA, et al. 2006. Are GM and nutrients and co' e conventionally bred cereals really different? Trends Food Sci. Technol. 18:201-9 antmutrients in a genetically 209. Sidhu RS,Hammond BG,Fuchs RL,Nlutz J-N,Holden LR,et al. 2000. Glyphosate- engineered 0 o tolerant corn:The composition and feeding value of grain from glyphosate-tolerant corn potatoes. ° is equivalent to that of conventional corn(Zea mays L.).J.Agric.Food Chem.48:2305-12 g N 210. Slater A,Scott NW,Fowler MW.2003.Plant Biotechnology:The Genetic Manipulation of . Plants.New York:Oxford Univ.Press 211. Smith JM.2003.Seeds of Deception.p. 19.Fairfield,IA:Yes!Books. 211.Frequently 212. See Ref.211,p.65 referenced book 213. See Ref.211,pp. 105-22 describing 214. Soil Assoc. 2007. 10 reasons to eat organic food. http://www.whyorganic.org/healthy_ perceived dangers tenReasons.asp of genetically 215. Song J,Bradeen JM,Naess KS, Raasch JA, Wielgus SM, et al. 2003. Gene RB cloned engineered crops and foods. from Solanum bulbocastanum confers broad spectrum resistance to potato late blight.Proc. Natl.Acad.Sci. USA 100:9128-33 216. Sorensen TL,Blom M,Monnet DL,Frimodt-Moller N,Poulsen RL,Espersen F.2001. Transient intestinal carriage after ingestion of antibiotic-resistant Enterococcus faecium from chicken and pork.N.Engl.J.Med. 345:1161-66 217. Soybean Tissue Cult.Genet.Eng.Cent.2007.Roundup Ready®soybean selected references. http://www.cropsoluga.edu/soy-engineering/RoundupReady.html 218. Stallknecht GF, Gilbertson KM, Ranney JE. 1996. Alternative wheat cereals as food grains:Einkorn,emmer,spelt,kamut,and triticale.In Progress in New Crops,ed.J Janick, pp. 156-70.Alexandria,VA:ASHS Press www.annuaire✓iews.org•Issues with GE Plants and Foods 809 219. Stanley JS,King N,Burks AW,Huang SK, Sampson H,et al. 1997.Identification and mutational analysis of the immunodominant IgE binding epitopes of the major peanut allergen Ara h 2.Arch.Biochem.Biophys.342:244-53 220. Stein AJ.2006.Micronutrient malnutrition and the impact of modern plant breeding on public health in India:How cost-effective is biofo tification?Gottingen:Cuvillier Verlag 221. Stephanopoulos G. 2007. Challenges in engineering microbes for biofuels production. Science 315:801-4 222. Steurich F,Feyerabend R. 1996.Allergy to kiwi fruit.Allergologie 19:367-78 223. Strachan T,Read AP. 1999.Genetic Manipulation of Animals.New York:Wiley 224. Tada Y,Nakase M,Adachi T,Nakamura R, Shimada H, et al. 1996.Reduction of 14- 16 kDa allergenic proteins in transgenic rice plants by antisense gene.FEES Lett.391:341- 45 225. Takagi H, Hiro T, Yang L, Tada Y, Yuki Y, et al. 2006. A rice-based edible vaccine o expressing multiple T cell epitopes induces oral tolerance for inhibition of Th2-mediated IgE responses.Proc.Natl.Acad.Sci. USA 102:17525-30 226. Takahashi S,Ito Y.2004.Evaluation of meat products from cloned cattle:Biological and biochemical properties.Cloning Stem Cells 6:165-71 227. Tarozzi A,Hrelia S,Angeloni C,Morroni F,Biagi P,et al.2005.Antioxidant effectiveness of organically and nonorganically grown red oranges in cell culture systems.Eur.J.Nutr. 45:152-58 • 2 228. Taylor ML, Hyun Y, Hartnell GF, Riordan SG, Nemeth MA, et al. 2003. Compari- a son of broiler performance when fed diets containing grain from YieldGard Rootworm o io (MON863),YieldGard Plus(MON810 x MON863),nontransgenic control,or commer- o cial reference corn hybrids.Poult. Sci.82:1948-56 G?N 229. Taylor NB, Fuchs RL, MacDonald J, Shariff AR, Padgette SR. 1999. Compositional co• o analysis of glyphosate-tolerant soybeans treated with glyphosate.J.Agric. Food Chem. 0 47:4469-73 M230. Taylor SL,Hefle SL.2002.Genetically engineered foods:implications for food allergy. o° C7111: Opin.Allergy Clin.Immunol.2:249-52 231. Teshima R,Akiyaina H,Ok-unuki H,Sakushima J,Goda Y,et al.2000.Effect of GM and non-GM soybeans on the immune system of BN rats and B10A mice.J.Food Hyg. Soc. Jpn.41:188-93 232. Tester M.1999.Seeking clarity in the debate over the safety of GM foods.Nature 402:575 233. Thanavala Y, Mahoney M, Pal S, Scott A, Richter L, et al. 2005. Immunogenicity in humans of an edible vaccine for hepatitis B.Proc.Natl.Acad.Sci. USA 102:3378-82 234. The Consumer Law Page. 1998.Contaminated L-tryptophan and 5-bydroxy-L-tryptophan, eosinophilia myalgia syndrome (EMS]: The 1989 epidemic and the 1998 warning. http:// consumerlawpage.com/article/tryptophan.shtml 235.Provides 235. Tian XC,Kubota C, Sakashita K,Izaike Y,Okano R, et al.2005.Meat and milk science-based compositions of bovine clones.Proc.Natl.Acad.Sci. USA 102:6261-66 information to 236. Tome D,Dubarry M,Fromentin G.2004.Nutritional value of milk and meat products address public derived from cloning.Cloning Stem Cells 6:172-77 concerns about the 237. Tomey F,Moeller I,Scarpa A,Wang K.2007.Genetic engineering approaches to improve safety of meat and bioethanol production from maize. Curs: Opin.Biotechnol. 18:193-99 milk from somatic animal clones 238. Tricoli DM,Carney KJ,Russell PF,McMaster JR,Groff DW,et al.1995.Field evaluation of transgenic squash containing single or multiple virus coat protein gene constructs for resistance to cucumber mosaic virus, watermelon mosaic virus 2 and zucchini yellow mosaic virus.Bio/Technology 13:1458-65 8io Lemma 239. Underwood BA,Smitasiri S. 1999.Micronutrient malnutrition: Policies and programs for control and their implications.Annu.Rev.Nuts. 19:303-24 240. Ungemach FR,Weber NE. 1998.Toxicological evaluation of certain veterinary drug residues in food. Presented at 15th Meet.Jt. FAO/WHO Expert Comm. Food Addit., Geneva, Switz. 241. UNICEF. 2001. A million children saved through vitamin A supplementation. httpi/ www.unicef.org/newsline/O1pr13.htm 242. US EPA Off.Pesticide Programs.2007.(Draft White Pap.)Concerning Dietaiy Exposure To Cry9c Protein Produced By Starlink®Corn And The Potential Risks Associated With Such Exposure,Oct. 16 243. Van der Westhuizen L,Shephard GS,Scussel VM,Costa LLF,Vismer HF, et al. 2003. Fumonisin contamination and Fusarium incidence in corn from Santa Carina,Brazil.j. Agric.Food Chem.51:5574-78 244. van Eenennaam A.2006. Genetic Engineering and Animal Agriculture.Univ.Calif.Agric. Nat.Resour.,Agric.Biotechnol.Calif.Ser.,Publ.8184 245. Vozza I,Ranghi G,Quaranta A.2005.Allergy and desensitization to latex.Clinical study a on 50 dentistry subjects.Minerva Stomatol. 54:237-45 246. Walsh MK,Lucey JA,Govindasamy-Lucey S,Pace MM,Bishop MD.2003.Comparison of milk produced by cows cloned by nuclear transfer with milk from non-cloned cows. B 24 Cloning Stem Cells 5:213-19 247. Wang Y, Zhang W, Cao J, McElroy D, Wu R. 1992. Characterization of cis-acting elements regulating transcription from the promoter of a constitutively active rice actin o w gene.Mol. Cell.Biol. 12:3399-406 248. Williamson C.2007.Is organic food better for our health?Mar.Bull. 32:104-8 A M 249. Wilmut I,Schnieke AF,McWhirJ,Kind AJ,Campbell Mi.1997.Viable offspring derived r,r4 from fetal and adult mammalian cells.Nature 385:810-13 to 250. World Health Org. (WHO). 2007. Micronutrient deficiencies, Vitamin A deficiency. M http://www.whoint/nutrition/topics/vadlen/ 251. World Health Org. (WHO). 2007. Micronutrients. http://www.who.int/nutrition/ topics/micronutrients/en/ 252. Wu F.2006.Mycotoxin reduction in Bt corn:potential economic,health,and regulatory *•O impacts. Trausgenic Res. 15:277-89 253. Yanagisawa S,Akiyama A,Kisaka H,Uchimiya H,Miwa T.2004.Metabolic engineering 1:4 with Dofl transcription factor in plants: Improved nitrogen assimilation and growth under low-nitrogen conditions.Proc.Natl.Acad.Sci. USA 101:7833-38 254. Ye X,Al-Babili S,Kloti A,ZhangJ,Lucca P,et al.2000.Engineering the provitamin A((3- carotene)biosynthetic pathway into(carotenoid-free)rice endosperm.Science 287:303- 5 255. Ynturi P,Jenkins JN,McCarty JC Jr.,Gutierrez OA,Saha S.2006.Association of root- knot nematode resistance genes with simple sequence repeat markers on two chromo- somes in cotton.Crop Sci.46:2670-74 256. Zavaleta N,Figueroa D,Rivera J,Sanchez J,Alfaro S,Lonnerdal B.2007.Efficacy of rice- based oral rehydration solution containing recombinant human lactoferrin and lysozyme in Peruvian children with acute diarrhea.J.Pediatr. Gastroenterol.Nutr.44:258-26 257. Zhang H-X, Hodson JN, Williams JP, Blumwald E. 2001. Engineering salt-tolerant Brassica plants: Characterization of yield and seed oil quality in transgenic plants with increased vacuolar sodium accumulation. Proc. Natl. Acad. Sci. USA 98:12832- 36 vvw.annualrevieus.ong•Issues with GE Plants and Foods Sir 258. Zhang W, Subbarao S,Addae P, Shen A,Armstrong C, et al. 2003. Cre/lox-mediated marker gene excision in transgenic maize (Zea mays L.) plants. Timor Appl. Genet. 107:1157-68 259. Zhu YZ,Li DF,Wang FL,Yin JD,Jin H.2004.Nutritional assessment and fate of DNA of soybean meal from roundup ready or conventional soybeans using rats.Arch.Anim. Nutr.58:295-310 260. Zarb C,Langenkatnper G,Betxche T,Niehaus K,Barsch A.2006.Metabolite profiling of wheat grains(Tiiticuin aestivum L.)from organic and conventional agriculture.].Agric. Food Chem.54:8301-6 0 ii 'T} 421 0 0 a 0 �w o- Q M •N 0 h c?`"0 0 O <5.; r kr,M 0 o N 00 O N_ Gn . Clr 812 Lemaux Annual Review of Plant Biology Contents Volume 59,2008 Our Work with Cyanogenic Plants Eric E. Conn 1 4 New Insights into Nitric Oxide Signaling in Plants An g eli q ue Besson-Bard,Alain Pugin,and David Wendehenne 21 _F Plant Immunity to Insect Herbivores Gregg A.Howe and Georg Dander 41 Patterning and Polarity in Seed Plant Shoots John L.Bowman and Sandra K.Floyd 67 ut w o • n E, Chlorophyll Fluorescence: A Probe of Photosynthesis In Vivo c w Neil R. Baker 89 • • A M Seed Storage Oil Mobilization • (V CO o Ian A. Graham 115 0 � o The Role of Glutathione in Photosynthetic Organisms: •. Emerging Functions for Glutaredoxins and Glutathionylation Nicolas Rouhier,Stephane D. Lemaire,and Jean-Pierre Jacquot 143 O N Algal Sensory Photoreceptors Peter Hegemann 167 a Plant Proteases:From Phenotypes to Molecular Mechanisms Renier A.L. van der Hoorn 191 GibbereIlin Metabolism and its Regulation Shinjiro Yamaguchi 225 Molecular Basis of Plant Architecture Yonghong Wang and Jiayang Li 253 Decoding of Light Signals by Plant Phytochromes and Their Interacting Proteins Gabyong Bae and Giltsu Choi 281 Flooding Stress:Acclimations and Genetic Diversity J. Bailey-Serres and L.A.C.J. V esenek 313 Roots,Nitrogen Transformations,and Ecosystem Services Louise E.Jackson,Martin Burger,and Timothy R. Cavagnaro 341 A Genetic Regulatory Network in the Development of Trichomes and Root Hairs Tetsuya Ishida, Tetsuya Kurata,Kiyotaka Okada,and Takuji Wade 365 Molecular Aspects of Seed Dormancy Ruth Finkelstein, Wendy Reeves, Tohru Ariizumi,and Camille Steber 387 Trehalose Metabolism and Signaling Matthew J.Paul, Lucia F Primavesi,Deveraj Jhurreea,and Yshua Zhang 417 Auxin:The Looping Star in Plant Development o Rene Benjarnins and Ben Scheres 443 6 Regulation of Guilin RING Ligases Sara K Hotton and Judy Callis 467 Plastid Evolution y Sven B. Gould,Ross F Waller;and Geoffrey I.McFadden 491 a Coordinating Nodule Morphogenesis with Rhizobial Infection ain Legumes Giles E.D. Oldroyd and J.Allan Downie 519 ° Structural and Signaling Networks for the Polar Cell Growth •N Machinery in Pollen Tubes 0o o o Alice Y Cheung and Hen-ming Wu 547 M Regulation and Identity of Florigen:FLOWERING LOCUS TMoves o0b 0 Center Stage o N Franziska Turck,Fabio Fornara,and George Coupland 573 Plant Aquaporins:Membrane Channels with Multiple Integrated Functions Christophe Maurel,Lionel V rdoucq,Doan-Trung Luu, and Veronique Santoni 595 Metabolic Flux Analysis in Plants:From Intelligent Design to Rational Engineering Igor G.L.Libourel and Yair Shachar-Hill 625 Mechanisms of Salinity Tolerance Rana Munns and Mark Tester 651 Sealing Plant Surfaces: Cuticular Wax Formation by Epidermal Cells Lacey Samuels,Ljerka Kunst,and Reinhard fetter 683 Ionomics and the Study of the Plant Ionome David E. Salt,Ivan Baxter,and Brett Lahner 709 vi Contents Alkaloid Biosynthesis:Metabolism and Trafficking o'rg Ziegler and Peter j.Facchini 735 Genetically Engineered Plants and Foods:A Scientist's Analysis of the Issues(Part I) Peggy G.Lemaux 771 Indexes Cumulative Index of Contributing Authors,Volumes 49-59 813 Cumulative Index of Chapter Tides,Volumes 49-59 818 Errata An online log of corrections to Annual Review of Plant Biology articles may be found at http://plant.annualreviews.org/ ". N "0 If. A oS 0 0 "aw ov. a M • N N CO.= CO A o M M M otP4R O.-r Or N r+ N N Contents vii